Skip to main content

Full text of "Godel, Escher, Bach - An Eternal Golden Braid"

See other formats


Overview viii 

List of Illustrations xiv 

Words of Thanks xix 

Part I: GEB 

Introduction: A Musico-Logical Offering 3 

Three-Part Invention 29 

Chapter I: The MU-puzzle 33 

Two-Part Invention 43 

Chapter II: Meaning and Form in Mathematics 46 

Sonata for Unaccompanied Achilles 6 1 

Chapter III: Figure and Ground 64 

Contracrostipunctus 75 

Chapter IV: Consistency, Completeness, and Geometry 82 

Little Harmonic Labyrinth 1 03 

Chapter V: Recursive Structures and Processes 127 

Canon by Intervallic Augmentation 153 

Chapter VI: The Location of Meaning 158 

Chromatic Fantasy, And Feud 177 

Chapter VII: The Propositional Calculus 181 

Crab Canon 199 

Chapter VIII: Typographical Number Theory 204 

A Mu Offering 231 

Chapter IX: Mumon and Godel 246 



Part II EGB 

Prelude ... 275 

Chapter X: Levels of Description, and Computer Systems 285 

Ant Fugue 311 

Chapter XI: Brains and Thoughts 337 

English French German Suit 366 

Chapter XII: Minds and Thoughts 369 

Aria with Diverse Variations 391 

Chapter XIII: BlooP and FlooP and GlooP 406 

Air on Gs String 431 
Chapter XIV: On Formally Undecidable Propositions of TNT 

and Related Systems 438 

Birthday Cantatatata ... 461 

Chapter XV: Jumping out of the System 465 

Edifying Thoughts of a Tobacco Smoker 480 

Chapter XVI: Self-Ref and Self-Rep 495 

The Magn fierab, Indeed 549 

Chapter XVII: Church, Turing, Tarski, and Others 559 

SHRDLU, Toy of Man's Designing 586 

Chapter XVIII: Artificial Intelligence: Retrospects 594 

Contrafactus 633 

Chapter XIX: Artificial Intelligence: Prospects 641 

Sloth Canon 681 

Chapter XX: Strange Loops, Or Tangled Hierarchies 684 

Six-Part Ricercar 720 

Notes 743 

Bibliography 746 

Credits 757 

Index 759 




Part I: GEB 

Introduction: A Musico-Logical Offering. The book opens with the story of Bach's Musical 
Offering. Bach made an impromptu visit to King Frederick the Great of Prussia, and was 
requested to improvise upon a theme presented by the King. His improvisations formed the basis 
of that great work. The Musical Offering and its story form a theme upon which I "improvise" 
throughout the book, thus making a sort of "Metamusical Offering". Self-reference and the 
interplay between different levels in Bach are discussed: this leads to a discussion of parallel 
ideas in Escher's drawings and then Godel's Theorem. A brief presentation of the history of logic 
and paradoxes is given as background for Godel's Theorem. This leads to mechanical reasoning 
and computers, and the debate about whether Artificial Intelligence is possible. I close with an 
explanation of the origins of the book-particularly the why and wherefore of the Dialogues. 

Three-Part Invention. Bach wrote fifteen three-part inventions. In this three-part Dialogue, the 
Tortoise and Achilles-the main fictional protagonists in the Dialogues-are "invented" by Zeno (as 
in fact they were, to illustrate Zeno's paradoxes of motion). Very short, it simply gives the flavor 
of the Dialogues to come. 

Chapter I: The MU-puzzle. A simple formal system (the MIL'-system) is presented, and the reader 
is urged to work out a puzzle to gain familiarity with formal systems in general. A number of 
fundamental notions are introduced: string, theorem, axiom, rule of inference, derivation, formal 
system, decision procedure, working inside/outside the system. 

Two-Part Invention. Bach also wrote fifteen two-part inventions. This two-part Dialogue was written 
not by me, but by Lewis Carroll in 1895. Carroll borrowed Achilles and the Tortoise from Zeno, 
and I in turn borrowed them from Carroll. The topic is the relation between reasoning, reasoning 
about reasoning, reasoning about reasoning about reasoning, and so on. It parallels, in a way, 
Zeno's paradoxes about the impossibility of motion, seeming to show, by using infinite regress, 
that reasoning is impossible. It is a beautiful paradox, and is referred to several times later in the 

Chapter II: Meaning and Form in Mathematics. A new formal system (the pq-system) is 
presented, even simpler than the MlU-system of Chapter I. Apparently meaningless at first, its 
symbols are suddenly revealed to possess meaning by virtue of the form of the theorems they 
appear in. This revelation is the first important insight into meaning: its deep connection to 
isomorphism. Various issues related to meaning are then discussed, such as truth, proof, symbol 
manipulation, and the elusive concept, "form". 

Sonata for Unaccompanied Achilles. A Dialogue which imitates the Bach Sonatas for 
unaccompanied violin. In particular, Achilles is the only speaker, since it is a transcript of one 
end of a telephone call, at the far end of which is the Tortoise. Their conversation concerns the 
concepts of "figure" and "ground" in various 



contexts- e.g., Escher's art. The Dialogue itself forms an example of the distinction, since 
Achilles' lines form a "figure", and the Tortoise's lines-implicit in Achilles' lines-form a "ground". 

Chapter III: Figure and Ground. The distinction between figure and ground in art is compared to 
the distinction between theorems and nontheorems in formal systems. The question "Does a 
figure necessarily contain the same information as its ground%" leads to the distinction between 
recursively enumerable sets and recursive sets. 

Contracrostipunctus. This Dialogue is central to the book, for it contains a set of paraphrases of 
Godel's self-referential construction and of his Incompleteness Theorem. One of the paraphrases 
of the Theorem says, "For each record player there is a record which it cannot play." The 
Dialogue's title is a cross between the word "acrostic" and the word "contrapunctus", a Latin word 
which Bach used to denote the many fugues and canons making up his Art of the Fugue. Some 
explicit references to the Art of the Fugue are made. The Dialogue itself conceals some acrostic 

Chapter IV: Consistency, Completeness, and Geometry. The preceding Dialogue is explicated to 
the extent it is possible at this stage. This leads back to the question of how and when symbols in 
a formal system acquire meaning. The history of Euclidean and non-Euclidean geometry is given, 
as an illustration of the elusive notion of "undefined terms". This leads to ideas about the 
consistency of different and possibly "rival" geometries. Through this discussion the notion of 
undefined terms is clarified, and the relation of undefined terms to perception and thought 
processes is considered. 

Little Harmonic Labyrinth. This is based on the Bach organ piece by the same name. It is a playful 
introduction to the notion of recursive-i.e., nested structures. It contains stories within stories. The 
frame story, instead of finishing as expected, is left open, so the reader is left dangling without 
resolution. One nested story concerns modulation in music-particularly an organ piece which 
ends in the wrong key, leaving the listener dangling without resolution. 

Chapter V: Recursive Structures and Processes. The idea of recursion is presented in many 
different contexts: musical patterns, linguistic patterns, geometric structures, mathematical 
functions, physical theories, computer programs, and others. 

Canon by Intervallic Augmentation. Achilles and the Tortoise try to resolve the question, "Which 
contains more information-a record, or the phonograph which plays it This odd question arises 
when the Tortoise describes a single record which, when played on a set of different 
phonographs, produces two quite different melodies: B-A-C-H and C-A-G-E. It turns out, 
however, that these melodies are "the same", in a peculiar sense. 

Chapter VI: The Location of Meaning. A broad discussion of how meaning is split among coded 
message, decoder, and receiver. Examples presented include strands of DNA, undeciphered 
inscriptions on ancient tablets, and phonograph records sailing out in space. The relationship of 
intelligence to "absolute" meaning is postulated. 

Chromatic Fantasy, And Feud. A short Dialogue bearing hardly any resemblance, except in title, to 
Bach's Chromatic Fantasy and Fugue. It concerns the proper way to manipulate sentences so as 
to preserve truth-and in particular the question 



of whether there exist rules for the usage of the word "arid". This Dialogue has much in common 
with the Dialogue by Lewis Carroll. 

Chapter VII: The Propositional Calculus. It is suggested how words such as .,and" can be 
governed by formal rules. Once again, the ideas of isomorphism and automatic acquisition of 
meaning by symbols in such a system are brought up. All the examples in this Chapter, 
incidentally, are "Zentences"-sentences taken from Zen koans. This is purposefully done, 
somewhat tongue-in-cheek, since Zen koans are deliberately illogical stories. 

Crab Canon. A Dialogue based on a piece by the same name from the Musical Offering. Both are so 
named because crabs (supposedly) walk backwards. The Crab makes his first appearance in this 
Dialogue. It is perhaps the densest Dialogue in the book in terms of formal trickery and level- 
play. Godel, Escher, and Bach are deeply intertwined in this very short Dialogue. 

Chapter VIII: Typographical Number Theory. An extension of the Propositional Calculus called 
"TNT" is presented. In TNT, number-theoretical reasoning can be done by rigid symbol 
manipulation. Differences between formal reasoning and human thought are considered. 

A Mu Offering. This Dialogue foreshadows several new topics in the book. Ostensibly concerned 
with Zen Buddhism and koans, it is actually a thinly veiled discussion of theoremhood and 
nontheoremhood, truth and falsity, of strings in number theory. There are fleeting references to 
molecular biology-particular) the Genetic Code. There is no close affinity to the Musical 
Offering, other than in the title and the playing of self-referential games. 

Chapter IX: Mumon and Godel. An attempt is made to talk about the strange ideas of Zen 
Buddhism. The Zen monk Mumon, who gave well known commentaries on many koans, is a 
central figure. In a way, Zen ideas bear a metaphorical resemblance to some contemporary ideas 
in the philosophy of mathematics. After this "Zennery", Godel's fundamental idea of Godel- 
numbering is introduced, and a first pass through Godel's Theorem is made. 

Part II: EGB 

Prelude ... This Dialogue attaches to the next one. They are based on preludes and fugues from 
Bach's Well-Tempered Clavier. Achilles and the Tortoise bring a present to the Crab, who has a 
guest: the Anteater. The present turns out to be a recording of the W.T.C.; it is immediately put 
on. As they listen to a prelude, they discuss the structure of preludes and fugues, which leads 
Achilles to ask how to hear a fugue: as a whole, or as a sum of parts? This is the debate between 
holism and reductionism, which is soon taken up in the Ant Fugue. 

Chapter X: Levels of Description, and Computer Systems. Various levels of seeing pictures, 
chessboards, and computer systems are discussed. The last of these is then examined in detail. 
This involves describing machine languages, assembly languages, compiler languages, operating 
systems, and so forth. Then the discussion turns to composite systems of other types, such as 
sports teams, nuclei, atoms, the weather, and so forth. The question arises as to how man 
intermediate levels exist-or indeed whether any exist. 



...Ant Fugue. An imitation of a musical fugue: each voice enters with the same statement. The 
theme-holism versus reductionism-is introduced in a recursive picture composed of words 
composed of smaller words, etc. The words which appear on the four levels of this strange picture 
are "HOLISM", "REDLCTIONIsM", and "ML". The discussion veers off to a friend of the 
Anteater's Aunt Hillary, a conscious ant colony. The various levels of her thought processes are 
the topic of discussion. Many fugal tricks are ensconced in the Dialogue. As a hint to the reader, 
references are made to parallel tricks occurring in the fugue on the record to which the foursome 
is listening. At the end of the Ant Fugue, themes from the Prelude return, transformed 

Chapter XI: Brains and Thoughts. "How can thoughts he supported by the hardware of the brain is 
the topic of the Chapter. An overview of the large scale and small-scale structure of the brain is 
first given. Then the relation between concepts and neural activity is speculatively discussed in 
some detail. 

English French German Suite. An interlude consisting of Lewis Carroll's nonsense poem 
"Jabberwocky M together with two translations: one into French and one into German, both done 
last century. 

Chapter XII: Minds and Thoughts. The preceding poems bring up in a forceful way the question 
of whether languages, or indeed minds, can be "mapped" onto each other. How is communication 
possible between two separate physical brains: What do all human brains have in common? A 
geographical analogy is used to suggest an answer. The question arises, "Can a brain be 
understood, in some objective sense, by an outsider?" 

Aria with Diverse Variations. A Dialogue whose form is based on Bach's Goldberg Variations, and 
whose content is related to number- theoretical problems such as the Goldbach conjecture. This 
hybrid has as its main purpose to show how number theory's subtlety stems from the fact that 
there are many diverse variations on the theme of searching through an infinite space. Some of 
them lead to infinite searches, some of them lead to finite searches, while some others hover in 

Chapter XIII: BlooP and FlooP and GlooP. These are the names of three computer languages. 
BlooP programs can carry out only predictably finite searches, while FlooP programs can carry 
out unpredictable or even infinite searches. The purpose of this Chapter is to give an intuition for 
the notions of primitive recursive and general recursive functions in number theory, for they are 
essential in Godel's proof. 

Air on G's String. A Dialogue in which Godel's self-referential construction is mirrored in words. 
The idea is due to W. V. O. Quine. This Dialogue serves as a prototype for the next Chapter. 

Chapter XIV: On Formally Undecidable Propositions of TNT and Related Systems. This 
Chapter's title is an adaptation of the title of Godel's 1931 article, in which his Incompleteness 
Theorem was first published. The two major parts of Godel's proof are gone through carefully. It 
is shown how the assumption of consistency of TNT forces one to conclude that TNT (or any 
similar system) is incomplete. Relations to Euclidean and non-Euclidean geometry are discussed. 
Implications for the philosophy of mathematics are gone into with some care. 



Birthday Cantatatata ... In which Achilles cannot convince the wily and skeptical Tortoise that today 
is his (Achilles') birthday. His repeated but unsuccessful tries to do so foreshadow the 
repeatability of the Godel argument. 

Chapter XV: Jumping out of the System. The repeatability of Godel' s argument is shown, with 
the implication that TNT is not only incomplete, but "essentially incomplete The fairly notorious 
argument by J. R. Lucas, to the effect that Godel's Theorem demonstrates that human thought 
cannot in any sense be "mechanical", is analyzed and found to be wanting. 

Edifying Thoughts of a Tobacco Smoker. A Dialogue treating of many topics, with the thrust being 
problems connected with self-replication and self-reference. Television cameras filming 
television screens, and viruses and other subcellular entities which assemble themselves, are 
among the examples used. The title comes from a poem by J. S. Bach himself, which enters in a 
peculiar way. 

Chapter XVI: Self-Ref and Self-Rep. This Chapter is about the connection between self-reference 
in its various guises, and self- reproducing entities e.g., computer programs or DNA molecules). 
The relations between a self-reproducing entity and the mechanisms external to it which aid it in 
reproducing itself (e.g., a computer or proteins) are discussed-particularly the fuzziness of the 
distinction. How information travels between various levels of such systems is the central topic of 
this Chapter. 

The Magnificrab, Indeed. The title is a pun on Bach's Magnifacat in D. The tale is about the Crab, 
who gives the appearance of having a magical power of distinguishing between true and false 
statements of number theory by reading them as musical pieces, playing them on his flute, and 
determining whether they are "beautiful" or not. 

Chapter XVII: Church, Turing, Tarski, and Others. The fictional Crab of the preceding Dialogue 
is replaced by various real people with amazing mathematical abilities. The Church-Turing 
Thesis, which relates mental activity to computation, is presented in several versions of differing 
strengths. All are analyzed, particularly in terms of their implications for simulating human 
thought mechanically, or programming into a machine an ability to sense or create beauty. The 
connection between brain activity and computation brings up some other topics: the halting 
problem of Turing, and Tarski's Truth Theorem. 

SHRDLU, Toy of Man's Designing. This Dialogue is lifted out of an article by Terry Winograd on 
his program SHRDLU: only a few names have been changed. In it. a program communicates 
with a person about the so-called "blocks world" in rather impressive English. The computer 
program appears to exhibit some real understanding-in its limited world. The Dialogue's title is 
based on Jesu, joy of Mans Desiring, one movement of Bach's Cantata 147. 

Chapter XVIII: Artificial Intelligence: Retrospects, This Chapter opens with a discussion of the 
famous "Turing test"-a proposal by the computer pioneer Alan Turing for a way to detect the 
presence or absence of "thought" in a machine. From there, we go on to an abridged history of 
Artificial Intelligence. This covers programs that can-to some degree-play games, prove 
theorems, solve problems, compose music, do mathematics, and use "natural language" (e.g., 



Contrafactus. About how we unconsciously organize our thoughts so that we can imagine 
hypothetical variants on the real world all the time. Also about aberrant variants of this ability- 
such as possessed by the new character, the Sloth, an avid lover of French fries, and rabid hater of 

Chapter XIX: Artificial Intelligence: Prospects. The preceding Dialogue triggers a discussion of 
how knowledge is represented in layers of contexts. This leads to the modern Al idea of "frames". 
A frame-like way of handling a set of visual pattern puzzles is presented, for the purpose of 
concreteness. Then the deep issue of the interaction of concepts in general is discussed, which 
leads into some speculations on creativity. The Chapter concludes with a set of personal 
"Questions and Speculations" on Al and minds in general. 

Sloth Canon. A canon which imitates a Bach canon in which one voice plays the same melody as 
another, only upside down and twice as slowly, while a third voice is free. Here, the Sloth utters 
the same lines as the Tortoise does, only negated (in a liberal sense of the term) and twice as 
slowly, while Achilles is free. 

Chapter XX: Strange Loops, Or Tangled Hierarchies. A grand windup of many of the ideas 
about hierarchical systems and self-reference. It is concerned with the snarls which arise when 
systems turn back on themselves-for example, science probing science, government investigating 
governmental wrongdoing, art violating the rules of art, and finally, humans thinking about their 
own brains and minds. Does Godel's Theorem have anything to say about this last "snarl"? Are 
free will and the sensation of consciousness connected to Godel's Theorem? The Chapter ends by 
tying Godel, Escher, and Bach together once again. 

Six-Part Ricercar. This Dialogue is an exuberant game played with many of the ideas which have 
permeated the book. It is a reenactment of the story of the Musical Offering, which began the 
book; it is simultaneously a "translation" into words of the most complex piece in the Musical 
Offering: the Six-Part Ricercar. This duality imbues the Dialogue with more levels of meaning 
than any other in the book. Frederick the Great is replaced by the Crab, pianos by computers, and 
so on. Many surprises arise. The Dialogue's content concerns problems of mind, consciousness, 
free will, Artificial Intelligence, the Turing test, and so forth, which have been introduced earlier. 
It concludes with an implicit reference to the beginning of the book, thus making the book into 
one big self-referential loop, symbolizing at once Bach's music, Escher's drawings, and Godel's 



FIGURE 1. Johann Sebastian Bach, in 1748. From a painting by Elias Gottlieb 

FIGURE 1. Johann Sebastian Bach, in 1748. From a painting by Elias Gottlieb 

Introduction: A Musico-Logical Offering 



A Musico-Logical Offering 


FREDERICK THE GREAT, King of Prussia, came to power in 1740. Although he is 
remembered in history books mostly for his military astuteness, he was also devoted to 
the life of the mind and the spirit. His court in Potsdam was one of the great centers of 
intellectual activity in Europe in the eighteenth century. The celebrated mathematician 
Leonhard Euler spent twenty-five years there. Many other mathematicians and scientists 
came, as well as philosophers-including Voltaire and La Mettrie, who wrote some of their 
most influential works while there. 

But music was Frederick's real love. He was an avid flutist and composer. Some of his 
compositions are occasionally performed even to this day. Frederick was one of the first 
patrons of the arts to recognize the virtues of the newly developed "piano-forte" ("soft- 
loud"). The piano had been developed in the first half of the eighteenth century as a 
modification of the harpsichord. The problem with the harpsichord was that pieces could 
only be played at a rather uniform loudness-there was no way to strike one note more 
loudly than its neighbors. The "soft-loud", as its name implies, provided a remedy to this 
problem. From Italy, where Bartolommeo Cristofori had made the first one, the soft-loud 
idea had spread widely. Gottfried Silbermann, the foremost German organ builder of the 
day, was endeavoring to make a "perfect" piano-forte. Undoubtedly King Frederick was 
the greatest supporter of his efforts-it is said that the King owned as many as fifteen 
Silbermann pianos! 


Frederick was an admirer not only of pianos, but also of an organist and composer by the 
name of J. S. Bach. This Bach's compositions were somewhat notorious. Some called 
them "turgid and confused", while others claimed they were incomparable masterpieces. 
But no one disputed Bach's ability to improvise on the organ. In those days, being an 
organist not only meant being able to play, but also to extemporize, and Bach was known 
far and wide for his remarkable extemporizations. (For some delightful anecdotes about 
Bach's extemporization, see The Bach Reader, by H. T. David and A. Mendel.) 

In 1747, Bach was sixty-two, and his fame, as well as one of his sons, had reached 
Potsdam: in fact, Carl Philipp Emanuel Bach was the Capellmeister (choirmaster) at the 
court of King Frederick. For years the King had let it be known, through gentle hints to 
Philipp Emanuel, how 

Introduction: A Musico-Logical Offering 


pleased he would be to have the elder Bach come and pay him a visit; but this wish had 
never been realized. Frederick was particularly eager for Bach to try out his new 
Silbermann pianos, which lie (Frederick) correctly foresaw as the great new wave in 

It was Frederick's custom to have evening concerts of chamber music in his court. 
Often he himself would be the soloist in a concerto for flute Here we have reproduced a 
painting of such an evening by the German painter Adolph von Menzel, who, in the 
1800's, made a series of paintings illustrating the life of Frederick the Great. At the 
cembalo is C. P. E. Bach, and the figure furthest to the right is Joachim Quantz, the 
King's flute master-and the only person allowed to find fault with the King's flute 
playing. One May evening in 1747, an unexpected guest showed up. Johann Nikolaus 
Forkel, one of Bach's earliest biographers, tells the story 
as follows: 

One evening, just as lie was getting his flute ready, and his musicians were ssembled, 
an officer brought him a list of the strangers who had arrived. With his flute in his hand 
he ran ever the list, but immediately turned to the assembled musicians, and said, with a 
kind of agitation, "Gentlemen, old Bach is come." The Hute was now laid aside, and old 
Bach, who had alighted at his son's lodgings, was immediately summoned to the Palace. 
Wilhelm Friedemann, who accompanied his father, told me this story, and I must say 
that 1 still think with pleasure on the manner in which lie related it. At that time it was 
the fashion to make rather prolix compliments. The first appearance of J. S. Bach before 
se great a King, who did not even give him time to change his traveling dress for a 
black chanter's gown, must necessarily be attended with many apologies. I will net here 
dwell en these apologies, but merely observe, that in Wilhelm Friedemann's mouth they 
made a formal Dialogue between the King and the Apologist. 

But what is mere important than this is that the King gave up his Concert for this 
evening, and invited Bach, then already called the Old Bach, to try his fortepianos, 
made by Silbermann, which steed in several rooms of the palace. [Forkel here inserts 
this footnote: "The pianofortes manufactured by Silbermann, of Frevberg, pleased the 
King se much, that he resolved to buy them all up. He collected fifteen. I hear that they 
all now stand unfit for use in various corners of the Royal Palace."] The musicians went 
with him from room to room, and Bach was invited everywhere to try them and to play 
unpremeditated compositions. After he had gene en for some time, he asked the King to 
give him a subject for a Fugue, in order to execute it immediately without any 
preparation. The King admired the learned manner in which his subject was thus 
executed extempore: and, probably to see hew far such artt could be carried, expressed 
a wish to hear a Fugue with six Obligato parts. But as it is not every subject that is fit 
for such full harmony, Bach chose one himself, and immediately executed it to the 
astonishment of all present in the same magnificent and learned manner as he had done 
that of the King. His Majesty desired also to hear his performance en the organ. The 
next day therefore Bach was taken to all the organs in Potsdam, as lie had before been 
to Silbermann's fortepianos. After his return to Leipzig, he composed the subject, which 
he had received from the King, in three and six parts, added several artificial passages 
in strict canon to it, and had it engraved, under the title of "Musikalisches Opfer" 
[Musical Offering], and dedicated it to the Inventor.' 

Introduction: A Musico-Logical Offering 


Introduction: A Musico-Logical Offering 


FIGURE 3. The Royal Theme. 

When Bach sent a copy of his Musical Offering to the King, he included a dedicatory 
letter, which is of interest for its prose style if nothing else rather submissive and 
flattersome. From a modern perspective it seems comical. Also, it probably gives 
something of the flavor of Bach's apology for his appearance. 2 


In deepest humility I dedicate herewith to Your Majesty a musical offering, the 
noblest part of which derives from Your Majesty's own august hand. With awesome 
pleasure I still remember the very special Royal grace when, some time ago, during 
my visit in Potsdam, Your Majesty's Self deigned to play to me a theme for a fugue 
upon the clavier, and at the same time charged me most graciously to carry it out in 
Your Majesty's most august presence. To obey Your Majesty's command was my most 
humble dim. I noticed very soon, however, that, for lack of necessary preparation, the 
execution of the task did not fare as well as such an excellent theme demanded. I 
resoled therefore and promptly pledged myself to work out this right Royal theme 
more fully, and then make it known to the world. This resolve has now been carried 
out as well as possible, and it has none other than this irreproachable intent, to glorify, 
if only in a small point, the fame of a monarch whose greatness and power, as in all 
the sciences of war and peace, so especially in music, everyone must admire and 
revere. I make bold to add this most humble request: may Your Majesty deign to 
dignify the present modest labor with a gracious acceptance, and continue to grant 
Your Majesty's most august Royal grace to 

Your Majesty's 

most humble and obedient servant, 

Leipzig, July 7 1747 

Some twenty-seven years later, when Bach had been dead for twentyfour years, a Baron 
named Gottfried van Swieten-to whom, incidentally, Forkel dedicated his biography of 
Bach, and Beethoven dedicated his First Symphony-had a conversation with King 
Frederick, which he reported as follows: 

He [Frederick] spoke to me, among other things, of music, and of a great organist 
named Bach, who has been for a while in Berlin. This artist [Wilhelm Friedemann 
Bach] is endowed with a talent superior, in depth of harmonic knowledge and power 
of execution, to any 1 have heard or can imagine, while those who knew his father 
claim that he, in turn, was even greater. The King 

Introduction: A Musico-Logical Offering 


is of this opinion, and to prove it to me he sang aloud a chromatic fugue subject which 
he had given this old Bach, who on the spot had made of it a fugue in four parts, then 
in five parts, and finally in eight parts.' 

Of course there is no way of knowing whether it was King Frederick or Baron van 
Swieten who magnified the story into larger-than-life proportions. But it shows how 
powerful Bach's legend had become by that time. To give an idea of how extraordinary a 
six-part fugue is, in the entire Well-Tempered Clavier by Bach, containing forty-eight 
Preludes and Fugues, only two have as many as five parts, and nowhere is there a six-part 
fugue! One could probably liken the task of improvising a six-part fugue to the playing of 
sixty simultaneous blindfold games of chess, and winning them all. To improvise an 
eight-part fugue is really beyond human capability. 

In the copy which Bach sent to King Frederick, on the page preceding the first sheet of 
music, was the following inscription: 

cR^if lu£u Gn\\cUK\ic^uaGwmcaAAc^hh. 


("At the King's Command, the Song and the Remainder Resolved with Canonic Art.") 
Here Bach is punning on the word "canonic", since it means not only "with canons" but 
also "in the best possible way". The initials of this inscription are 


-an Italian word, meaning "to seek". And certainly there is a great deal to seek in the 
Musical Offering. It consists of one three-part fugue, one six-part fugue, ten canons, and a 
trio sonata. Musical scholars have concluded that the three-part fugue must be, in 
essence, identical with the one which Bach improvised for King Frederick. The six-part 
fugue is one of Bach's most complex creations, and its theme is, of course, the Royal 
Theme. That theme, shown in Figure 3, is a very complex one, rhythmically irregular and 
highly chromatic (that is, filled with tones which do not belong to the key it is in). To 
write a decent fugue of even two voices based on it would not be easy for the average 

Both of the fugues are inscribed "Ricercar", rather than "Fuga". This is another 
meaning of the word; "ricercar" was, in fact, the original name for the musical form now 
known as "fugue". By Bach's time, the word "fugue" (or fuga, in Latin and Italian) had 
become standard, but the term "ricercar" had survived, and now designated an erudite 
kind of fugue, perhaps too austerely intellectual for the common ear. A similar usage 
survives in English today: the word "recherche" means, literally, "sought out", but carries 
the same kind of implication, namely of esoteric or highbrow cleverness. 

The trio sonata forms a delightful relief from the austerity of the fugues and canons, 
because it is very melodious and sweet, almost dance- 

Introduction: A Musico-Logical Offering 


able. Nevertheless, it too is based largely on the King's theme, chromatic and austere as it 
is. It is rather miraculous that Bach could use such a theme to make so pleasing an 

The ten canons in the Musical Offering are among the most sophisticated canons Bach 
ever wrote. However, curiously enough, Bach himself never wrote them out in full. This 
was deliberate. They were posed as puzzles to King Frederick. It was a familiar musical 
game of the day to give a single theme, together with some more or less tricky hints, and 
to let the canon based on that theme be "discovered" by someone else. In order to know 
how this is possible, you must understand a few facts about canons. 

Canons and Fugues 

The idea of a canon is that one single theme is played against itself. This is done by 
having "copies" of the theme played by the various participating voices. But there are 
means' ways to do this. The most straightforward of all canons is the round, such as 
"Three Blind Mice", "Row, Row, Row Your Boat", or " Frere Jacques". Here, the theme 
enters in the first voice and, after a fixed time-delay, a "copy" of it enters, in precisely the 
same key. After the same fixed time-delay in the second voice, the third voice enters 
carrying the theme, and so on. Most themes will not harmonize with themselves in this 
way. In order for a theme to work as a canon theme, each of its notes must be able to 
serve in a dual (or triple, or quadruple) role: it must firstly be part of a melody, and 
secondly it must be part of a harmonization of the same melody. When there are three 
canonical voices, for instance, each note of the theme must act in two distinct harmonic 
ways, as well as melodically. Thus, each note in a canon has more than one musical 
meaning; the listener's ear and brain automatically figure out the appropriate meaning, by 
referring to context. 

There are more complicated sorts of canons, of course. The first escalation in 
complexity comes when the "copies" of the theme are staggered not only in time, but also 
in pitch; thus, the first voice might sing the theme starting on C, and the second voice, 
overlapping with the first voice, might sing the identical theme starting five notes higher, 
on G. A third voice, starting on the D yet five notes higher, might overlap with the first 
two, and so on. The next escalation in complexity comes when the speeds of the different 
voices are not equal; thus, the second voice might sing twice as quickly, or twice as 
slowly, as the first voice. The former is called diminution, the latter augmentation (since 
the theme seems to shrink or to expand). 

We are not yet done! The next stage of complexity in canon construction is to invert the 
theme, which means to make a melody which jumps down wherever the original theme 
jumps up, and by exactly the same number of semitones. This is a rather weird melodic 
transformation, but when one has heard many themes inverted, it begins to seem quite 
natural. Bach was especially fond of inversions, and they show up often in his work-and 
the Musical Offering is no exception. (For a simple example of 

Introduction: A Musico-Logical Offering 


inversion, try the tune "Good King Wenceslas". When the original and its inversion are 
sung together, starting an octave apart and staggered with a time-delay of two beats, a 
pleasing canon results.) Finally, the most esoteric of "copies" is the retrograde copy- 
where the theme is played backwards in time. A canon which uses this trick is 
affectionately known as a crab canon, because of the peculiarities of crab locomotion. 
Bach included a crab canon in the Musical Offering, needless to say. Notice that every 
type of "copy" preserves all the information in the original theme, in the sense that the 
theme is fully recoverable from any of the copies. Such an information preserving 
transformation is often called an isomorphism, and we will have much traffic with 
isomorphisms in this book. 

Sometimes it is desirable to relax the tightness of the canon form. One way is to allow 
slight departures from perfect copying, for the sake of more fluid harmony. Also, some 
canons have "free" voices-voices which do not employ the canon's theme, but which 
simply harmonize agreeably with the voices that are in canon with each other. 

Each of the canons in the Musical Offering has for its theme a different variant of the 
King's Theme, and all the devices described above for making canons intricate are 
exploited to the hilt; in fact, they are occasionally combined. Thus, one three-voice canon 
is labeled "Canon per Augmentationem, contrario Motu"; its middle voice is free (in fact, 
it sings the Royal Theme), while the other two dance canonically above and below it, 
using the devices of augmentation and inversion. Another bears simply the cryptic label 
"Quaerendo invenietis" ("By seeking, you will discover"). All of the canon puzzles have 
been solved. The canonical solutions were given by one of Bach's pupils, Johann Philipp 
Kirnberger. But one might still wonder whether there are more solutions to seek! 

I should also explain briefly what a fugue is. A fugue is like a canon, in that it is 
usually based on one theme which gets played in different voices and different keys, and 
occasionally at different speeds or upside down or backwards. However, the notion of 
fugue is much less rigid than that of canon, and consequently it allows for more 
emotional and artistic expression. The telltale sign of a fugue is the way it begins: with a 
single voice singing its theme. When it is done, then a second voice enters, either five 
scale-notes up, or four down. Meanwhile the first voice goes on, singing the 
"countersubject": a secondary theme, chosen to provide rhythmic, harmonic, and melodic 
contrasts to the subject. Each of the voices enters in turn, singing the theme, often to the 
accompaniment of the countersubject in some other voice, with the remaining voices 
doing whatever fanciful things entered the composer's mind. When all the voices have 
"arrived", then there are no rules. There are, to be sure, standard kinds of things to do-but 
not so standard that one can merely compose a fugue by formula. The two fugues in the 
Musical Offering are outstanding examples of fugues that could never have been 
"composed by formula". There is something much deeper in them than mere fugality. 

All in all, the Musical Offering represents one of Bach's supreme accomplishments in 
counterpoint. It is itself one large intellectual fugue, in 

Introduction: A Musico-Logical Offering 


which many ideas and forms have been woven together, and in which playful double 
meanings and subtle allusions are commonplace. And it is a very beautiful creation of the 
human intellect which we can appreciate forever. (The entire work is wonderfully 
described in the book f. S. Bach's Musical Offering, by H. T. David.) 

An Endlessly Rising Canon 

There is one canon in the Musical Offering which is particularly unusual. Labeled simply 
"Canon per Tonos", it has three voices. The uppermost voice sings a variant of the Royal 
Theme, while underneath it, two voices provide a canonic harmonization based on a 
second theme. The lower of this pair sings its theme in C minor (which is the key of the 
canon as a whole), and the upper of the pair sings the same theme displaced upwards in 
pitch by an interval of a fifth. What makes this canon different from any other, however, 
is that when it concludes-or, rather, seems to conclude-it is no longer in the key of C 
minor, but now is in D minor. Somehow Bach has contrived to modulate (change keys) 
right under the listener's nose. And it is so constructed that this "ending" ties smoothly 
onto the beginning again; thus one can repeat the process and return in the key of E, only 
to join again to the beginning. These successive modulations lead the ear to increasingly 
remote provinces of tonality, so that after several of them, one would expect to be 
hopelessly far away from the starting key. And yet magically, after exactly six such 
modulations, the original key of C minor has been restored! All the voices are exactly one 
octave higher than they were at the beginning, and here the piece may be broken off in a 
musically agreeable way. Such, one imagines, was Bach's intention; but Bach indubitably 
also relished the implication that this process could go on ad infinitum, which is perhaps 
why he wrote in the margin "As the modulation rises, so may the King's Glory." To 
emphasize its potentially infinite aspect, I like to call this the "Endlessly Rising Canon". 

In this canon, Bach has given us our first example of the notion of Strange Loops. The 
"Strange Loop" phenomenon occurs whenever, by moving upwards (or downwards) 
through the levels of some hierarchical system, we unexpectedly find ourselves right 
back where we started. (Here, the system is that of musical keys.) Sometimes I use the 
term Tangled Hierarchy to describe a system in which a Strange Loop occurs. As we go 
on, the theme of Strange Loops will recur again and again. Sometimes it will be hidden, 
other times it will be out in the open; sometimes it will be right side up, other times it will 
be upside down, or backwards. "Quaerendo invenietis" is my advice to the reader. 


To my mind, the most beautiful and powerful visual realizations of this notion of Strange 
Loops exist in the work of the Dutch graphic artist M. C. Escher, who lived from 1902 to 
1972. Escher was the creator of some of the 

Introduction: A Musico-Logical Offering 


FIGURE 5. Waterfall, by M. C. Escher (lithograph, 1961). 

most intellectually stimulating drawings of all time. Many of them have their origin in 
paradox, illusion, or double-meaning. Mathematicians were among the first admirers of 
Escher's drawings, and this is understandable because they often are based on 
mathematical principles of symmetry or pattern ... But there is much more to a typical 
Escher drawing than just symmetry or pattern; there is often an underlying idea, realized 
in artistic form. And in particular, the Strange Loop is one of the most recurrent themes in 
Escher's work. Look, for example, at the lithograph Waterfall (Fig. 5), and compare its 
six-step endlessly falling loop with the six-step endlessly rising loop of the "Canon per 
Tonos". The similarity of vision is 

Introduction: A Musico-Logical Offering 


Introduction: A Musico-Logical Offering 


remarkable. Bach and Escher are playing one single theme in two different "keys": music 
and art. 

Escher realized Strange Loops in several different ways, and they can be arranged 
according to the tightness of the loop. The lithograph Ascending and Descending (Fig. 6), 
in which monks trudge forever in loops, is the loosest version, since it involves so many 
steps before the starting point is regained. A tighter loop is contained in Waterfall, which, 
as we already observed, involves only six discrete steps. You may be thinking that there 
is some ambiguity in the notion of a single "step"-for instance, couldn't Ascending and 
Descending be seen just as easily as having four levels (staircases) as forty-five levels 
(stairs) % It is indeed true that there is an inherent 

FIGURE 7. Hand with Reflecting Globe. Self-portrait In, M. C. Escher (lithograph, 


Introduction: A Musico-Logical Offering 


Introduction: A Musico-Logical Offering 


haziness in level-counting, not only in Escher pictures, but in hierarchical, many-level 
systems. We will sharpen our understanding of this haziness later on. But let us not get 
too distracted now' As we tighten our loop, we come to the remarkable Drawing Hands 
(Fig. 135), in which each of two hands draws the other: a two-step Strange Loop. And 
finally, the tightest of all Strange Loops is realized in Print Gallery (Fig. 142): a picture 
of a picture which contains itself. Or is it a picture of a gallery which contains itself? Or 
of a town which contains itself? Or a young man who contains himself? (Incidentally, the 
illusion underlying Ascending and Descending and Waterfall was not invented by Escher, 
but by Roger Penrose, a British mathematician, in 1958. However, the theme of the 
Strange Loop was already present in Escher's work in 1948, the year he drew Drawing 
Hands. Print Gallery dates from 1956.) 

Implicit in the concept of Strange Loops is the concept of infinity, since what else is a 
loop but a way of representing an endless process in a finite way? And infinity plays a 
large role n many of Escher's drawings. Copies of one single theme often fit into each' 
other, forming visual analogues to the canons of Bach. Several such patterns can be seen 
in Escher's famous print Metamorphosis (Fig. 8). It is a little like the "Endlessly Rising 
Canon": wandering further and further from its starting point, it suddenly is back. In the 
tiled planes of Metamorphosis and other pictures, there are already suggestions of 
infinity. But wilder visions of infinity appear in other drawings by Escher. In some of his 
drawings, one single theme can appear on different levels of reality. For instance, one 
level in a drawing might clearly be recognizable as representing fantasy or imagination; 
another level would be recognizable as reality. These two levels might be the only 
explicitly portrayed levels. But the mere presence of these two levels invites the viewer to 
look upon himself as part of yet another level; and by taking that step, the viewer cannot 
help getting caught up in Escher's implied chain of levels, in which, for any one level, 
there is always another level above it of greater "reality", and likewise, there is always a 
level below, "more imaginary" than it is. This can be mind-boggling in itself. However, 
what happens if the chain of levels is not linear, but forms a loop? What is real, then, and 
what is fantasy? The genius of Escher was that he could not only concoct, but actually 
portray, dozens of half-real, half-mythical worlds, worlds filled with Strange Loops, 
which he seems to be inviting his viewers to enter. 


In the examples we have seen of Strange Loops by Bach and Escher, there is a conflict 
between the finite and the infinite, and hence a strong sense of paradox. Intuition senses 
that there is something mathematical involved here. And indeed in our own century a 
mathematical counterpart was discovered, with the most enormous repercussions. And, 
just as the Bach and Escher loops appeal to very simple and ancient intuitions-a musical 
scale, a staircase-so this discovery, by K. Godel, of a Strange Loop in 

Introduction: A Musico-Logical Offering 


FIGURE 9. Kurt Godel. 

Introduction: A Musico-Logical Offering 

mathematical systems has its origins in simple and ancient intuitions. In its absolutely 
barest form, Godel's discovery involves the translation of an ancient paradox in 
philosophy into mathematical terms. That paradox is the so-called Epimenides paradox, 
or liar paradox. Epimenides was a Cretan who made one immortal statement: "All 
Cretans are liars." A sharper version of the statement is simply "I am lying"; or, "This 
statement is false". It is that last version which I will usually mean when I speak of the 
Epimenides paradox. It is a statement which rudely violates the usually assumed 
dichotomy of statements into true and false, because if you tentatively think it is true, 
then it immediately backfires on you and makes you think it is false. But once you've 
decided it is false, a similar backfiring returns you to the idea that it must be true. Try it! 

The Epimenides paradox is a one-step Strange Loop, like Escher's Print Gallery. But 
how does it have to do with mathematics? That is what Godel discovered. His idea was to 
use mathematical reasoning in exploring mathematical reasoning itself. This notion of 
making mathematics "introspective" proved to be enormously powerful, and perhaps its 
richest implication was the one Godel found: Godel's Incompleteness Theorem. What the 
Theorem states and how it is proved are two different things. We shall discuss both in 
quite some detail in this book. The Theorem can De likened to a pearl, and the method of 
proof to an oyster. The pearl is prized for its luster and simplicity; the oyster is a complex 
living beast whose innards give rise to this mysteriously simple gem. 

Godel's Theorem appears as Proposition VI in his 1931 paper "On Formally 
Undecidable Propositions in Principia Mathematica and Related Systems I." It states: 

To every w-consistent recursive class K of formulae there correspond recursive 
class-signs r, such that neither v Gen r nor Neg (v Gen r) belongs to Fig (K) (where v 
is the free variable of r). 

Actually, it was in German, and perhaps you feel that it might as well be in German 
anyway. So here is a paraphrase in more normal English: 

All consistent axiomatic formulations of number theory 
include undecidable propositions. 

This is the pearl. 

In this pearl it is hard to see a Strange Loop. That is because the Strange Loop is buried 
in the oyster-the proof. The proof of Godel's Incompleteness Theorem hinges upon the 
writing of a self-referential mathematical statement, in the same way as the Epimenides 
paradox is a self-referential statement of language. But whereas it is very simple to talk 
about language in language, it is not at all easy to see how a statement about numbers can 
talk about itself. In fact, it took genius merely to connect the idea of self-referential 
statements with number theory. Once Godel had the intuition that such a statement could 
be created, he was over the major hurdle. The actual creation of the statement was the 
working out of this one beautiful spark of intuition. 

Introduction: A Musico-Logical Offering 


We shall examine the Godel construction quite carefully in Chapters to come, but so that 
you are not left completely in the dark, I will sketch here, in a few strokes, the core of the 
idea, hoping that what you see will trigger ideas in your mind. First of all, the difficulty 
should be made absolutely clear. Mathematical statements-let us concentrate on number- 
theoretical ones-are about properties of whole numbers. Whole numbers are not 
statements, nor are their properties. A statement of number theory is not about a. 
statement of number theory; it just is a statement of number theory. This is the problem; 
but Godel realized that there was more here than meets the eye. 

Godel had the insight that a statement of number theory could be about a statement of 
number theory (possibly even itself), if only numbers could somehow stand for 
statements. The idea of a code, in other words, is at the heart of his construction. In the 
Godel Code, usually called "Godel-numbering", numbers are made to stand for symbols 
and sequences of symbols. That way, each statement of number theory, being a sequence 
of specialized symbols, acquires a Godel number, something like a telephone number or a 
license plate, by which it can be referred to. And this coding trick enables statements of 
number theory to be understood on two different levels: as statements of number theory, 
and also as statements about statements of number theory. 

Once Godel had invented this coding scheme, he had to work out in detail a way of 
transporting the Epimenides paradox into a numbertheoretical formalism. His final 
transplant of Epimenides did not say, "This statement of number theory is false", but 
rather, "This statement of number theory does not have any proof. A great deal of 
confusion can be caused by this, because people generally understand the notion of 
"proof rather vaguely. In fact, Godel's work was just part of a long attempt by 
mathematicians to explicate for themselves what proofs are. The important thing to keep 
in mind is that proofs are demonstrations within fixed systems of propositions. In the case 
of Godel's work, the fixed system of numbertheoretical reasoning to which the word 
"proof refers is that of Principia Mathematica (P.M.), a giant opus by Bertrand Russell 
and Alfred North Whitehead, published between 1910 and 1913. Therefore, the Godel 
sentence G should more properly be written in English as: 

This statement of number theory does not have any proof in the system of Principia 

Incidentally, this Godel sentence G is not Godel's Theorem-no more than the Epimenides 
sentence is the observation that "The Epimenides sentence is a paradox." We can now 
state what the effect of discovering G is. Whereas the Epimenides statement creates a 
paradox since it is neither true nor false, the Godel sentence G is unprovable (inside 
P.M.) but true. The grand conclusion% That the system of Principia Mathematica is 
"incomplete"-there are true statements of number theory which its methods of proof are 
too weak to demonstrate. 

Introduction: A Musico-Logical Offering 


But if Principia Mathematica was the first victim of this stroke, it was certainly not the 
last! The phrase "and Related Systems" in the title of Godel's article is a telling one: for if 
Godel's result had merely pointed out a defect in the work of Russell and Whitehead, then 
others could have been inspired to improve upon P.M. and to outwit Godel's Theorem. 
But this was not possible: Godel's proof pertained to any axiomatic system which 
purported to achieve the aims which Whitehead and Russell had set for themselves. And 
for each different system, one basic method did the trick. In short, Godel showed that 
provability is a weaker notion than truth, no matter what axiomatic system is involved. 

Therefore Godel's Theorem had an electrifying effect upon logicians, mathematicians, 
and philosophers interested in the foundations of mathematics, for it showed that no fixed 
system, no matter how complicated, could represent the complexity of the whole 
numbers: 0, 1, 2, 3, ... Modern readers may not be as nonplussed by this as readers of 
1931 were, since in the interim our culture has absorbed Godel's Theorem, along with the 
conceptual revolutions of relativity and quantum mechanics, and their philosophically 
disorienting messages have reached the public, even if cushioned by several layers of 
translation (and usually obfuscation). There is a general mood of expectation, these days, 
of "limitative" results-but back in 1931, this came as a bolt from the blue. 

Mathematical Logic: A Synopsis 

A proper appreciation of Godel's Theorem requires a setting of context. Therefore, I will 
now attempt to summarize in a short space the history of mathematical logic prior to 
1931 -an impossible task. (See DeLong, Kneebone, or Nagel and Newman, for good 
presentations of history.) It all began with the attempts to mechanize the thought 
processes of reasoning. Now our ability to reason has often been claimed to be what 
distinguishes us from other species; so it seems somewhat paradoxical, on first thought, 
to mechanize that which is most human. Yet even the ancient Greeks knew that reasoning 
is a patterned process, and is at least partially governed by statable laws. Aristotle 
codified syllogisms, and Euclid codified geometry; but thereafter, many centuries had to 
pass before progress in the study of axiomatic reasoning would take place again. 

One of the significant discoveries of nineteenth-century mathematics was that there are 
different, and equally valid, geometries- where by "a geometry" is meant a theory of 
properties of abstract points and lines. It had long been assumed that geometry was what 
Euclid had codified, and that, although there might be small flaws in Euclid's 
presentation, they were unimportant and any real progress in geometry would be 
achieved by extending Euclid. This idea was shattered by the roughly simultaneous 
discovery of non-Euclidean geometry by several people-a discovery that shocked the 
mathematics community, because it deeply challenged the idea that mathematics studies 
the real world. How could there be many differ 

Introduction: A Musico-Logical Offering 


ent kinds of "points" and "lines" in one single reality? Today, the solution to the dilemma 
may be apparent, even to some nonmathematicians-but at the time, the dilemma created 
havoc in mathematical circles. 

Later in the nineteenth century, the English logicians George Boole and Augustus De 
Morgan went considerably further than Aristotle in codifying strictly deductive reasoning 
patterns. Boole even called his book "The Laws of Thoughf'-surely an exaggeration, but 
it was an important contribution. Lewis Carroll was fascinated by these mechanized 
reasoning methods, and invented many puzzles which could be solved with them. Gottlob 
Frege in Jena and Giuseppe Peano in Turin worked on combining formal reasoning with 
the study of sets and numbers. David Hilbert in Gottingen worked on stricter 
formalizations of geometry than Euclid's. All of these efforts were directed towards 
clarifying what one means by "proof. 

In the meantime, interesting developments were taking place in classical mathematics. 
A theory of different types of infinities, known as the theory of sets, was developed by 
Georg Cantor in the 1880's. The theory was powerful and beautiful, but intuition-defying. 
Before long, a variety of set-theoretical paradoxes had been unearthed. The situation was 
very disturbing, because just as mathematics seemed to be recovering from one set of 
paradoxes-those related to the theory of limits, in the calculusalong came a whole new 
set, which looked worse! 

The most famous is Russell's paradox. Most sets, it would seem, are not members of 
themselves-for example, the set of walruses is not a walrus, the set containing only Joan 
of Arc is not Joan of Arc (a set is not a person)-and so on. In this respect, most sets are 
rather "run-of-the-mill". However, some "self-swallowing" sets do contain themselves as 
members, such as the set of all sets, or the set of all things except Joan of Arc, and so on. 
Clearly, every set is either run-of-the-mill or self-swallowing, and no set can be both. 
Now nothing prevents us from inventing R: the set of all run-o,-the-mill sets. At first, R 
might seem a rather run-of-the-mill invention-but that opinion must be revised when you 
ask yourself, "Is R itself "a run-of-the-mill set or a self-swallowing set?" You will find 
that the answer is: "R is neither run-of-the-mill nor self-swallowing, for either choice 
leads to paradox." Try it! 

But if R is neither run-of-the-mill nor self-swallowing, then what is it? At the very 
least, pathological. But no one was satisfied with evasive answers of that sort. And so 
people began to dig more deeply into the foundations of set theory. The crucial questions 
seemed to be: "What is wrong with our intuitive concept of 'set'? Can we make a rigorous 
theory of sets which corresponds closely with our intuitions, but which skirts the 
paradoxes?" Here, as in number theory and geometry, the problem is in trying to line up 
intuition with formalized, or axiomatized, reasoning systems. 

A startling variant of Russell's paradox, called "Grelling's paradox", can be made using 
adjectives instead of sets. Divide the adjectives in English into two categories: those 
which are self-descriptive, such as "pentasyllable", "awkwardnessful", and "recherche", 
and those which are not, such 

Introduction: A Musico-Logical Offering 


as "edible", "incomplete", and "bisyllabic". Now if we admit "non-selfdescriptive" as an 
adjective, to which class does it belong? If it seems questionable to include hyphenated 
words, we can use two terms invented specially for this paradox: autological (= "self- 
descriptive"), and heterological (= "non-self-descriptive"). The question then becomes: 
"Is 'heterological' heterological?" Try it! 

There seems to he one common culprit in these paradoxes, namely self-reference, or 
"Strange Loopiness". So if the goal is to ban all paradoxes, why not try banning self- 
reference and anything that allows it to arise? This is not so easy as it might seem, 
because it can be hard to figure out just where self-reference is occurring. It may be 
spread out over a whole Strange Loop with several steps, as in this "expanded" version of 
Epimenides, reminiscent of Drawing Hands: 

The following sentence is false. 
The preceding sentence is true. 

Taken together, these sentences have the same effect as the original Epimenides paradox: 
yet separately, they are harmless and even potentially useful sentences. The "blame" for 
this Strange Loop can't he pinned on either sentence-only on the way they "point" at each 
other. In the same way, each local region of Ascending and Descending is quite 
legitimate; it is only the way they are globally put together that creates an impossibility. 
Since there are indirect as well as direct ways of achieving self-reference, one must figure 
out how to ban both types at once-if one sees selfreference as the root of all evil. 
Banishing Strange Loops 

Russell and Whitehead did subscribe to this view, and accordingly, Principia 
Mathematica was a mammoth exercise in exorcising Strange Loops from logic, set 
theory, and number theory. The idea of their system was basically this. A set of the 
lowest "type" could contain only "objects" as membersnot sets. A set of the next type up 
could only contain objects, or sets of the lowest type. In general, a set of a given type 
could only contain sets of lower type, or objects. Every set would belong to a specific 
type. Clearly, no set could contain itself because it would have to belong to a type higher 
than its own type. Only "run-of-the-mill" sets exist in such a system; furthermore, old li- 
the set of all run-of-the-mill sets-no longer is considered a set at all, because it does not 
belong to any finite type. To all appearances, then, this theory of types, which we might 
also call the "theory of the abolition of Strange Loops", successfully rids set theory of its 
paradoxes, but only at the cost of introducing an artificial-seeming hierarchy, and of 
disallowing the formation of certain kinds of sets-such as the set of all run-of-the-mill 
sets. Intuitively, this is not the way we imagine sets. 

The theory of types handled Russell's paradox, but it did nothing about the Epimenides 
paradox or Grelling's paradox. For people whose 

Introduction: A Musico-Logical Offering 


interest went no further than set theory, this was quite adequate -but for people interested 
in the elimination of paradoxes generally, some similar "hierarchization" seemed 
necessary, to forbid looping back inside language. At the bottom of such a hierarchy 
would be an object language. Here, reference could be made only to a specific domain- 
not to aspects of the object language itself (such as its grammatical rules, or specific 
sentences in it). For that purpose there would be a metalanguage. This experience of two 
linguistic levels is familiar to all learners of foreign languages. Then there would be a 
metametalanguage for discussing the metalanguage, and so on. It would be required that 
every sentence should belong to some precise level of the hierarchy. Therefore, if one 
could find no level in which a given utterance fit, then the utterance would be deemed 
meaningless, and forgotten. 

An analysis can be attempted on the two-step Epimenides loop given above. The first 
sentence, since it speaks of the second, must be on a higher level than the second. But by 
the same token, the second sentence must be on a higher level than the first. Since this is 
impossible, the two sentences are "meaningless". More precisely, such sentences simply 
cannot be formulated at all in a system based on a strict hierarchy of languages. This 
prevents all versions of the Epimenides paradox as well as Grelling's paradox. (To what 
language level could "heterological" belong?) 

Now in set theory, which deals with abstractions that we don't use all the time, a 
stratification like the theory of types seems acceptable, even if a little strange-but when it 
comes to language, an all-pervading part of life, such stratification appears absurd. We 
don't think of ourselves as jumping up and down a hierarchy of languages when we speak 
about various things. A rather matter-of-fact sentence such as, "In this book, I criticize 
the theory of types" would be doubly forbidden in the system we are discussing. Firstly, it 
mentions "this book", which should only be mentionable in a 

metabook"-and secondly, it mentions me-a person whom I should not be allowed to 
speak of at all! This example points out how silly the theory of types seems, when you 
import it into a familiar context. The remedy it adopts for paradoxes-total banishment of 
self-reference in any form-is a real case of overkill, branding many perfectly good 
constructions as meaningless. The adjective "meaningless", by the way, would have to 
apply to all discussions of the theory of linguistic types (such as that of this very 
paragraph) for they clearly could not occur on any of the levels-neither object language, 
nor metalanguage, nor metametalanguage, etc. So the very act of discussing the theory 
would be the most blatant possible violation of it! 

Now one could defend such theories by saying that they were only intended to deal 
with formal languages-not with ordinary, informal language. This may be so, but then it 
shows that such theories are extremely academic and have little to say about paradoxes 
except when they crop up in special tailor-made systems. Besides, the drive to eliminate 
paradoxes at any cost, especially when it requires the creation of highly artificial 
formalisms, puts too much stress on bland consistency, and too little on the 

Introduction: A Musico-Logical Offering 


quirky and bizarre, which make life and mathematics interesting. It is of course important 
to try to maintain consistency, but when this effort forces you into a stupendously ugly 
theory, you know something is wrong. 

These types of issues in the foundations of mathematics were responsible for the high 
interest in codifying human reasoning methods which was present in the early part of this 
century. Mathematicians and philosophers had begun to have serious doubts about 
whether even the most concrete of theories, such as the study of whole numbers (number 
theory), were built on solid foundations. If paradoxes could pop up so easily in set 
theory-a theory whose basic concept, that of a set, is surely very intuitively appealing- 
then might they not also exist in other branches of mathematics? Another related worry 
was that the paradoxes of logic, such as the Epimenides paradox, might turn out to be 
internal to mathematics, and thereby cast in doubt all of mathematics. This was especially 
worrisome to those-and there were a good number-who firmly believed that mathematics 
is simply a branch of logic (or conversely, that logic is simply a branch of mathematics). 
In fact, this very question-" Are mathematics and logic distinct, or separate%"-was the 
source of much controversy. 

This study of mathematics itself became known as metamathematics-or occasionally, 
metalogic, since mathematics and logic are so intertwined. The most urgent priority of 
metamathematicians was to determine the true nature of mathematical reasoning. What is 
a legal method of procedure, and what is an illegal one? Since mathematical reasoning 
had always been done in "natural language" (e.g., French or Latin or some language for 
normal communication), there was always a lot of possible ambiguity. Words had 
different meanings to different people, conjured up different images, and so forth. It 
seemed reasonable and even important to establish a single uniform notation in which all 
mathematical work could be done, and with the aid of which any two mathematicians 
could resolve disputes over whether a suggested proof was valid or not. This would 
require a complete codification of the universally acceptable modes of human reasoning, 
at least as far as they applied to mathematics. 

Consistency, Completeness, Hilbert's Program 

This was the goal of Principia Mathematica, which purported to derive all of mathematics 
from logic, and, to be sure, without contradictions! It was widely admired, but no one 
was sure if (1) all of mathematics really was contained in the methods delineated by 
Russell and Whitehead, or (2) the methods given were even self-consistent. Was it 
absolutely clear that contradictory results could never be derived, by any mathematicians 
whatsoever, following the methods of Russell and Whitehead? 

This question particularly bothered the distinguished German mathematician (and 
metamathematician) David Hilbert, who set before the world community of 
mathematicians (and metamathematicians) this chal 

Introduction: A Musico-Logical Offering 


lenge: to demonstrate rigorously-perhaps following the very methods outlined by Russell 
and Whitehead-that the system defined in Principia Mathematica was both consistent 
(contradiction-free), and complete (i.e., that every true statement of, number theory could 
be derived within the framework drawn up in P.M.). This was a tall order, and one could 
criticize it on the grounds that it was somewhat circular: how can you justify your 
methods of reasoning on the basis of those same methods of reasoning? It is like lifting 
yourself up by your own bootstraps. (We just don't seem to be able to get away from 
these Strange Loops!) 

Hilbert was fully aware of this dilemma, of course, and therefore expressed the hope 
that a demonstration of consistency or completeness could be found which depended only 
on "finitistic" modes of reasoning, "these were a small set of reasoning methods usually 
accepted by mathematicians. In this way, Hilbert hoped that mathematicians could 
partially lift themselves by their own bootstraps: the sum total of mathematical methods 
might be proved sound, by invoking only a smaller set of methods. This goal may sound 
rather esoteric, but it occupied the minds of many of the greatest mathematicians in the 
world during the first thirty years of this century. 

In the thirty-first year, however, Godel published his paper, which in some ways 
utterly demolished Hilbert's program. This paper revealed not only that there were 
irreparable "holes" in the axiomatic system proposed by Russell and Whitehead, but more 
generally, that no axiomatic system whatsoever could produce all number-theoretical 
truths, unless it were an inconsistent system! And finally, the hope of proving the 
consistency of a system such as that presented in P.M. was shown to be vain: if such a 
proof could be found using only methods inside P.M., then-and this is one of the most 
mystifying consequences of Godel's work-P.M. itself would be inconsistent! 

The final irony of it all is that the proof of Gi del's Incompleteness Theorem involved 
importing the Epimenides paradox right into the heart ofPrincipia Mathematica, a bastion 
supposedly invulnerable to the attacks of Strange Loops! Although Godel's Strange Loop 
did not destroy Principia Mathematica, it made it far less interesting to mathematicians, 
for it showed that Russell and Whitehead's original aims were illusory. 

Babbage, Computers, Artificial Intelligence ... 

When Godel's paper came out, the world was on the brink of developing electronic digital 
computers. Now the idea of mechanical calculating engines had been around for a while. 
In the seventeenth century, Pascal and Leibniz designed machines to perform fixed 
operations (addition and multiplication). These machines had no memory, however, and 
were not, in modern parlance, programmable. 

The first human to conceive of the immense computing potential of machinery was the 
Londoner Charles Babbage (1792-1871). A character who could almost have stepped out 
of the pages of the Pickwick Papers, 

Introduction: A Musico-Logical Offering 


Babbage was most famous during his lifetime for his vigorous campaign to rid London 
of "street nuisances" -organ grinders above all. These pests, loving to get his goat, would 
come and serenade him at any time of day or night, and he would furiously chase them 
down the street. Today, we recognize in Babbage a man a hundred years ahead of his 
time: not only inventor of the basic principles of modern computers, he was also one of 
the first to battle noise pollution. 

His first machine, the "Difference Engine", could generate mathematical tables of 
many kinds by the "method of differences". But before any model of the "D.E." had been 
built, Babbage became obsessed with a much more revolutionary idea: his "Analytical 
Engine". Rather immodestly, he wrote, "The course through which I arrived at it was the 
most entangled and perplexed which probably ever occupied the human mind.'" Unlike 
any previously designed machine, the A.E. was to possess both a "store" (memory) and a 
"mill" (calculating and decision-making unit). These units were to be built of thousands 
of intricate geared cylinders interlocked in incredibly complex ways. Babbage had a 
vision of numbers swirling in and out of the mill tinder control of a program contained in 
punched cards-an idea inspired by the jacquard loom, a card-controlled loom that wove 
amazingly complex patterns. Babbage's brilliant but ill-fated Countess friend, Lady Ada 
Lovelace (daughter of Lord Byron), poetically commented that "the Analytical Engine 
weaves algebraic patterns just as the Jacquard-loom weaves flowers and leaves." 
Unfortunately, her use of the present tense was misleading, for no A.E. was ever built, 
and Babbage died a bitterly disappointed man. 

Lady Lovelace, no less than Babbage, was profoundly aware that with the invention of 
the Analytical Engine, mankind was flirting with mechanized intelligence-particularly if 
the Engine were capable of "eating its own tail" (the way Babbage described the Strange 
Loop created when a machine reaches in and alters its own stored program). In an 1842 
memoir,5 she wrote that the A.E. "might act upon other things besides number". While 
Babbage dreamt of creating_ a chess or tic-tac-toe automaton, she suggested that his 
Engine, with pitches and harmonies coded into its spinning cylinders, "might compose 
elaborate and scientific pieces of music of any degree of complexity or extent." In nearly 
the same breath, however, she cautions that "The Analytical Engine has no pretensions 
whatever to originate anything. It can do whatever we know how to order it to perform." 
Though she well understood the power of artificial computation, Lady Lovelace was 
skeptical about the artificial creation of intelligence. However, could her keen insight 
allow her to dream of the potential that would be opened up with the taming of 

In our century the time was ripe for computers-computers beyond the wildest dreams of 
Pascal, Leibniz, Babbage, or Lady Lovelace. In the 1930's and 1940's, the first "giant 
electronic brains" were designed and built. They catalyzed the convergence of three 
previously disparate areas: the theory of axiomatic reasoning, the study of mechanical 
computation, and the psychology of intelligence. 
These same years saw the theory of computers develop by leaps and 

Introduction: A Musico-Logical Offering 


bounds. This theory was tightly linked to metamathematics. In fact, Godel's Theorem has 
a counterpart in the theory of computation, discovered by Alan Turing, which reveals the 
existence of inelucPable "holes" in even the most powerful computer imaginable. 
Ironically, just as these somewhat eerie limits were being mapped out, real computers 
were being built whose powers seemed to grow and grow beyond their makers' power of 
prophecy. Babbage, who once declared he would gladly give up the rest of his life if he 
could come back in five hundred years and have a three-day guided scientific tour of the 
new age, would probably have been thrilled speechless a mere century after his death- 
both by the new machines, and by their unexpected limitations. 

By the early 1950's, mechanized intelligence seemed a mere stone's throw away; and 
yet, for each barrier crossed, there always cropped up some new barrier to the actual 
creation of a genuine thinking machine. Was there some deep reason for this goal's 
mysterious recession? 

No one knows where the borderline between non-intelligent behavior and intelligent 
behavior lies; in fact, to suggest that a sharp borderline exists is probably silly. But 
essential abilities for intelligence are certainly: 

to respond to situations very flexibly; 

to take advantage of fortuitous circumstances; 

to make sense out of ambiguous or contradictory messages; 

to recognize the relative importance of different elements of a 


to find similarities between situations despite differences which may separate them; 
to draw distinctions between situations despite similarities may link them; 
to synthesize new concepts by taking old them together in new ways; to come up 
with ideas which are novel. 

Here one runs up against a seeming paradox. Computers by their very nature are the 
most inflexible, desireless, rule-following of beasts. Fast though they may be, they are 
nonetheless the epitome of unconsciousness. How, then, can intelligent behavior be 
programmed? Isn't this the most blatant of contradictions in terms? One of the major 
theses of this book is that it is not a contradiction at all. One of the major purposes of this 
book is to urge each reader to confront the apparent contradiction head on, to savor it, to 
turn it over, to take it apart, to wallow in it, so that in the end the reader might emerge 
with new insights into the seemingly unbreathable gulf between the formal and the 
informal, the animate and the inanimate, the flexible and the inflexible. 

This is what Artificial Intelligence (Al) research is all about. And the strange flavor of 
AI work is that people try to put together long sets of rules in strict formalisms which tell 
inflexible machines how to be flexible. 

What sorts of "rules" could possibly capture all of what we think of as intelligent 
behavior, however? Certainly there must be rules on all sorts of 

Introduction: A Musico-Logical Offering 


different levels. There must be many "just plain" rules. There must be "metarules" to 
modify the "just plain" rules; then "metametarules" to modify the metarules, and so on. 
The flexibility of intelligence comes from the enormous number of different rules, and 
levels of rules. The reason that so many rules on so many different levels must exist is 
that in life, a creature is faced with millions of situations of completely different types. In 
some situations, there are stereotyped responses which require "just plain" rules. Some 
situations are mixtures of stereotyped situations-thus they require rules for deciding 
which of the just plain" rules to apply. Some situations cannot be classified-thus there 
must exist rules for inventing new rules ... and on and on. Without doubt, Strange Loops 
involving rules that change themselves, directly or indirectly, are at the core of 
intelligence. Sometimes the complexity of our minds seems so overwhelming that one 
feels that there can be no solution to the problem of understanding intelligence-that it is 
wrong to think that rules of any sort govern a creature's behavior, even if one takes "rule" 
in the multilevel sense described above. 

...and Bach 

In the year 1754, four years after the death of J. S. Bach, the Leipzig theologian Johann 
Michael Schmidt wrote, in a treatise on music and the soul, the following noteworthy 

Not many years ago it was reported from France that a man had made a statue that 
could play various pieces on the Fleuttraversiere, placed the flute to its lips and took it 
down again, rolled its eyes, etc. But no one has yet invented an image that thinks, or 
wills, or composes, or even does anything at all similar. Let anyone who wishes to be 
convinced look carefully at the last fugal work of the above-praised Bach, which has 
appeared in copper engraving, but which was left unfinished because his blindness 
intervened, and let him observe the art that is contained therein; or what must strike 
him as even more wonderful, the Chorale which he dictated in his blindness to the pen 
of another: Wenn wir in hochsten Nothen seen. I am sure that he will soon need his 
soul if he wishes to observe all the beauties contained therein, let alone wishes to play 
it to himself or to form a judgment of the author. Everything that the 
champions of Materialism put forward must fall to the ground in view of this 
single example. 6 

Quite likely, the foremost of the "champions of Materialism" here alluded to was none 
other than Julien Offroy de la Mettrie-philosopher at the court of Frederick the Great, 
author of L'homme machine ("Man, the Machine"), and Materialist Par Excellence. It is 
now more than 200 years later, and the battle is still raging between those who agree with 
Johann Michael Schmidt, and those who agree with Julien Offroy de la Mettrie. I hope in 
this book to give some perspective on the battle. 

"Godel, Escher, Bach" 

The book is structured in an unusual way: as a counterpoint between Dialogues and 
Chapters. The purpose of this structure is to allow me to 

Introduction: A Musico-Logical Offering 


present new concepts twice: almost every new concept is first presented metaphorically 
in a Dialogue, yielding a set of concrete, visual images; then these serve, during the 
reading of the following' Chapter, as an intuitive background for a more serious and 
abstract presentation of the same concept. In many of the Dialogues I appear to be talking 
about one idea on the surface, but in reality I am talking about some other idea, in a thinly 
disguised way. 

Originally, the only characters in my Dialogues were Achilles and the Tortoise, who 
came to me from Zeno of Elea, by way of Lewis Carroll. Zeno of Elea, inventor of 
paradoxes, lived in the fifth century B.C. One of his paradoxes was an allegory, with 
Achilles and the Tortoise as protagonists. Zeno's invention of the happy pair is told in my 
first Dialogue, Three-Part Invention. In 1895, Lewis Carroll reincarnated Achilles and the 
Tortoise for the purpose of illustrating his own new paradox of infinity. Carroll's paradox, 
which deserves to be far better known than it is, plays a significant role in this book. 
Originally titled "What the Tortoise Said to Achilles", it is reprinted here as Two-Part 

When I began writing Dialogues, somehow I connected them up with musical forms. I 
don't remember the moment it happened; I just remember one day writing "Fugue" above 
an early Dialogue, and from then on the idea stuck. Eventually I decided to pattern each 
Dialogue in one way or another on a different piece by Bach. This was not so 
inappropriate. Old Bach himself used to remind his pupils that the separate parts in their 
compositions should behave like "persons who conversed together as if in a select 
company". I have taken that suggestion perhaps rather more literally than Bach intended 
it; nevertheless I hope the result is faithful to the meaning. I have been particularly 
inspired by aspects of Bach's compositions which have struck me over and over, and 
which are so well described by David and Mendel in The Bach Reader: 
His form in general was based on relations between separate sections. These relations 
ranged from complete identity of passages on the one hand to the 

return of a single principle of elaboration or a mere thematic allusion on the other. The 
resulting patterns were often symmetrical, but by no means 

necessarily so. Sometimes the relations between the various sections make up a maze of 
interwoven threads that only detailed analysis can unravel. Usually, 
however, a few dominant features afford proper orientation at first sight or hearing, and 
while in the course of study one may discover unending sub 

tleties, one is never at a loss to grasp the unity that holds together every single creation by 

I have sought to weave an Eternal Golden Braid out of these three strands: Godel, 
Escher, Bach. I began, intending to write an essay at the core of which would be Godel's 
Theorem. I imagined it would be a mere pamphlet. But my ideas expanded like a sphere, 
and soon touched Bach and Escher. It took some time for me to think of making this 
connection explicit, instead of just letting it be a private motivating force. But finally 1 
realized that to me, Godel and Escher and Bach were only shadows cast in different 
directions by some central solid essence. I tried to reconstruct the central object, and 
came up with this book. 

Introduction: A Musico-Logical Offering 


Three-Part Invention 

Achilles (a Greek warrior, the fleetest of foot of all mortals) and a Tortoise are 
standing together on a dusty runway in the hot sun. Far down the runway, on a 
tall flagpole, there hangs a large rectangular flag. The flag is sold red, except 
where a thin ring-shaped holes has been cut out of it, through which one can see 
the sky. 

ACHILLES: What is that strange flag down at the other end of the track? It reminds me 

somehow of a print by my favourite artists M.C. Escher. 
TORTOISE: That is Zeno' s flag 

ACHILLES: Could it be that the hole in it resembles the holes in a Mobian strip Escher once 

drew? Something is wrong about the flag, I can tell. 
TORTOISE: The ring which has been cut from it has the shape of the numeral for zero, which 

is Zeno's favourite number. 
ACHILLES: The ring which hasn't been invented yet! It will only be invented by a Hindu 

mathematician some millennia hence. And thus, Mr. T, mt argument proves that such a 

flag is impossible. 

TORTOISE: Your argument is persuasive, Achilles, and I must agree that such a flag is indeed 

impossible. But it is beautiful anyway, is it not? 
ACHILLES: Oh, yes, there is no doubt of its beauty. 

TORTOISE: I wonder if it's beauty is related to it's impossibility. I don't know, I've never had 
the time to analyze Beauty. It's a Capitalized Essence, and I never seem to have time for 
Capitalized Essences. 

ACHILLES: Speaking of Capitalized Essences, Mr. T, have you ever wondered about the 

Purpose of Life? 
TORTOISE: Oh, heavens, no; 

ACHILLES: Haven't you ever wondered why we are here, or who invented us? 

TORTOISE: Oh, that is quite another matter. We are inventions of Zeno (as you will shortly 

see) and the reason we are here is to have a footrace. 
ACHILLES::: A footrace? How outrageous! Me, the fleetest of foot of all mortals, versus you, 

the ploddingest of the plodders! There can be no point to such a race. 
TORTOISE: You might give me a head start. 
ACHILLES: It would have to be a huge one. 
TORTOISE: I don't object. 

ACHILLES: But I will catch you, sooner or later - most likely sooner. 

TORTOISE: Not if things go according to Zeno's paradox, you won't. Zeno is hoping to use 
our footrace to show that motion is impossible, you see. It is only in the mind that motion 
seems possible, according to Zeno. In truth, Motion Is Inherently Impossible. He proves 
it quite elegantly. 

Three-Part Invention 


Figure 10. Mobius strip by M.C.Escher (wood-engraving printed from four blocks, 1961) 

ACHILLES: Oh, yes, it comes back to me now: the famous Zen koan about Zen 

Master Zeno. As you say it is very simple indeed. 
TORTOISE: Zen Koan? Zen Master? What do you mean? 

ACHILLES: It goes like this: Two monks were arguing about a flag. One said, "The 
flag is moving." The other said, "The wind is moving." The sixth patriarch, Zeno, 
happened to be passing by. He told them, "Not the wind, not the flag, mind is 

TORTOISE: I am afraid you are a little befuddled, Achilles. Zeno is no Zen master, far 
from it. He is in fact, a Greek philosopher from the town of Elea (which lies halfway 
between points A and B). Centuries hence, he will be celebrated for his paradoxes of 
motion. In one of those paradoxes, this very footrace between you and me will play a 
central role. 

ACHILLES: I'm all confused. I remember vividly how I used to repeat over and over 
the names of the six patriarchs of Zen, and I always said, "The sixth patriarch is Zeno, 
The sixth patriarch is Zeno..." {Suddenly a soft warm breeze picks up.) Oh, look Mr. 
Tortoise - look at the flag waving! How I love to watch the ripples shimmer through 
it's soft fabric. And the ring cut out of it is waving, too! 

Three-Part Invention 


TORTOISE: Don't be silly. The flag is impossible, hence it can't be waving. The wind is 

(At this moment, Zeno happens by.) 

Zeno: Hallo! Hulloo! What's up? What's new? 
ACHILLES: The flag is moving. 
TORTOISE: The wind is moving. 

Zeno: O friends, Friends! Cease your argumentation! Arrest your vitriolics! Abandon your 

discord! For I shall resolve the issue for you forthwith. Ho! And on such a fine day. 
ACHILLES: This fellow must be playing the fool. 

TORTOISE: No, wait, Achilles. Let us hear what he has to say. Oh Unknown Sir, do impart to 

us your thoughts on this matter. 
Zeno: Most willingly. Not thw ind, not the flag - neither one is moving, nor is anything moving 

at all. For I have discovered a great Theorem, which states; "Motion Is Inherently 

Impossible." And from this Theorem follows an even greater Theorem - Zeno's 

Theorem: "Motion Unexists." 
ACHILLES: "Zeno's Theorem"? Are you, sir, by any chance, the philosopher Zeno of Elea? 
Zeno: I am indeed, Achilles. 

ACHILLES: (scratching his head in puzzlement). Now how did he know my name? 

Zeno: Could I possibly persuade you two to hear me out as to why this is the case? I've come 
all the way to Elea from point A this afternoon, just trying to find someone who'll pay 
some attention to my closely honed argument. But they're all hurrying hither and thither, 
and they don't have time. You've no idea how disheartening it is to meet with refusal 
after refusal. Oh, I'm sorry to burden you with my troubles, I'd just like to ask you one 
thing: Would the two of you humour a sill old philosopher for a few moments - only a 
few, I promise you - in his eccentric theories. 

ACHILLES: Oh, by all means! Please do illuminate us! I know I speak for both of us, since my 
companion, Mr. Tortoise, was only moments ago speaking of you with great veneration - 
and he mentioned especially your paradoxes. 

Zeno: Thank you. You see, my Master, the fifth patriarch, taught me that reality is one, 
immutable, and unchanging, all plurality, change, and motion are mere illusions of the 
sense. Some have mocked his views; but I will show the absurdity of their mockery. My 
argument is quite simple. I will illustrate it with two characters of my own Invention: 
Achilles )a Greek warrior, the fleetest of foot of all mortals), and a Tortoise. In my tale, 
they are persuaded by a passerby to run a footrace down a runway towards a distant flag 
waving in the breeze. Let us assume that, since the Tortoise is a much slowerrunner, he 
gets a head start of, say, ten rods. Now the race begins. In a few bounds Achilles has 
reached the spot where the Tortoise started. 

Three-Part Invention 



Zeno: And now the Tortoise is but a single rod ahead of Achilles. Within only a moment, 

Achilles has attained that spot. 

Zeno: Yet, in that short moment, the Tortoise has managed to advance a slight amount. In a 

flash, Achilles covers that distance too. 
ACHILLES : Hee hee hee ! 

Zeno: But in that very short flash, the Tortoise has managed to inch ahead by ever so little, and 
so Achilles is still behind. Now you see that in order for Achilles to catch the Tortoise, 
this game of "try-to-catch-me" will have to be played an INFINITE number of times - 
and therefore Achilles can NEVER catch up with the Tortoise. 

TORTOISE: Heh heh heh heh! 

ACHILLES: Hmm... Hmm... Hmm... Hmm... Hmm...That argument sounds wrong to me. 

And yes, I can't quite make out what's wrong with it 
Zeno: Isn't it a teaser? It's my favourite paradox. 

TORTOISE: Excuse me, Zeno, but I believe your tale illustrates the wrong principle, doe sit 
not? You have just told us what will come to known, centuries hence, as Zeno's "Achilles 
paradox" , which shows (ahem!) that Achilles will never catch the Tortoise; but the proof 
that Motion Is Inherently Impossible (and thence that Motion Unexists) is your 
"dichotomy paradox", isn't that so? 

Zeno: Oh, shame on me. Of course, you're right. That's the new one about how, in going from 
A to B, one has to go halfway first - and of that stretch one also has to go halfway, and so 
on and so forth. But you see, both those paradoxes really have the same flavour. Frankly, 
I've only had one Great Idea - I just exploit it in different ways. 

ACHILLES: I swear, these arguments contain a flaw. I don't quite see where, but they cannot 
be correct. 

Zeno: You doubt the validity of my paradox? Why not just try it out|? You see that red flag 

waving down here, at the far end of the runway? 
ACHILLES: The impossible one, based on an Escher print? 

Zeno: Exactly. What do you say to you and Mr. Tortoise racing for it, allowing Mr. T a fair 

head start of, well, I don't know - 
TORTOISE: How about ten rods? 
Zeno: Very good - ten rods. 
ACHILLES: Any time. 

Zeno: Excellent! How exciting! An empirical test of my rigorously proven Theorem! Mr. 
Tortoise, will you position yourself ten rods upwind? 

( The Tortoise moves ten rods closer to the flag) 

Tortoise and Achlles: Ready! 
Zeno: On your mark! Get set! Go! 

Three-Part Invention 


Chapter 1 

The MU-puzzle 

Formal Systems 

ONE OF THE most central notions in this book is that of a formal system. The type of 
formal system I use was invented by the American logician Emil Post in the 1920's, and 
is often called a "Post production system". This Chapter introduces you to a formal 
system and moreover, it is my hope that you will want to explore this formal system at 
least a little; so to provoke your curiosity, I have posed a little puzzle. 

"Can you produce MU?" is the puzzle. To begin with, you will be supplied with a 
string (which means a string of letters).* Not to keep you in suspense, that string will be 
MI. Then you will be told some rules, with which you can change one string into another. 
If one of those rules is applicable at some point, and you want to use it, you may, but- 
there is nothing that will dictate which rule you should use, in case there are several 
applicable rules. That is left up to you-and of course, that is where playing the game of 
any formal system can become something of an art. The major point, which almost 
doesn't need stating, is that you must not do anything which is outside the rules. We 
might call this restriction the "Requirement of Formality". In the present Chapter, it 
probably won't need to be stressed at all. Strange though it may sound, though, I predict 
that when you play around with some of the formal systems of Chapters to come, you 
will find yourself violating the Requirement of Formality over and over again, unless you 
have worked with formal systems before. 

The first thing to say about our formal system-the MlU-system-is that it utilizes 
only three letters of the alphabet: M, I, U. That means that the only strings of the MIU- 
system are strings which are composed of those three letters. Below are some strings of 
the MlU-system: 




* In this book, we shall employ the following conventions when we refer to strings. When the 
string is in the same typeface as the text, then it will be enclosed in single or double quotes. 
Punctuation which belongs to the sentence and not to the string under discussion will go outside 
of the quotes, as logic dictates. For example, the first letter of this sentence is 'F', while the first 
letter of 'this 'sentence'. is 't'. When the string is in Quadrata Roman, however, quotes will 
usually be left off, unless clarity demands them. For example, the first letter of Quadrata is Q. 

The MU-puzzle 


But although all of these are legitimate strings, they are not strings which are "in your 
possession". In fact, the only string in your possession so far is MI. Only by using the 
rules, about to be introduced, can you enlarge your private collection. Here is the first 

RULE I: If you possess a string whose last letter is I, you can add on a U at the end. 

By the way, if up to this point you had not guessed it, a fact about the meaning of "string" 
is that the letters are in a fixed order. For example, MI and IM are two different strings. 
A string of symbols is not just a "bag" of symbols, in which the order doesn't make any 

Here is the second rule: 

RULE II: Suppose you have Mx. Then you may add Mxx to your collection. 

What I mean by this is shown below, in a few examples. 

From MIU, you may get MIUIU. 
From MUM, you may get MUMUM. 
From MU, you may get MUU. 

So the letter V in the rule simply stands for any string; but once you have decided which 
string it stands for, you have to stick with your choice (until you use the rule again, at 
which point you may make a new choice). Notice the third example above. It shows how, 
once you possess MU, you can add another string to your collection; but you have to get 
MU first! I want to add one last comment about the letter V: it is not part of the formal 
system in the same way as the three letters 'M', 'I', and 'U' are. It is useful for us, 
though, to have some way to talk in general about strings of the system, symbolically-and 
that is the function of the V: to stand for an arbitrary string. If you ever add a string 
containing an Y to your "collection", you have done something wrong, because strings of 
the MlU-system never contain "x" "s"! 
Here is the third rule: 

RULE III: If III occurs in one of the strings in your collection, you may make a new 
string with U in place of III. 


From UMIIIMU, you could make UMUMU. 
From MII11, you could make MIU (also MUI). 
From IIMII, you can't get anywhere using this rule. 

(The three I's have to be consecutive.) 
From Mill, make MU. 

Don't, under any circumstances, think you can run this rule backwards, as in the 
following example: 

The MU-puzzle 


From MU, make Mill 

<- This is wrong. 

Rules are one-way. 

Here is the final rule. 

RULE IV: If UU occurs inside one of your strings, you can drop it. 

From UUU, get U. 


There you have it. Now you may begin trying to make MU. Don't worry you don't get it. 
Just try it out a bit-the main thing is for you to get the flavor of this MU-puzzle. Have 

Theorems, Axioms, Rules 

The answer to the MU-puzzle appears later in the book. For now, what important is not 
finding the answer, but looking for it. You probably hay made some attempts to produce 
MU. In so doing, you have built up your own private collection of strings. Such strings, 
producible by the rules, are called theorems. The term "theorem" has, of course, a 
common usage mathematics which is quite different from this one. It means some 
statement in ordinary language which has been proven to be true by a rigorous argument, 
such as Zeno's Theorem about the "unexistence" of motion, c Euclid's Theorem about the 
infinitude of primes. But in formal system theorems need not be thought of as statements- 
they are merely strings c symbols. And instead of being proven, theorems are merely 
produced, as if F machine, according to certain typographical rules. To emphasize this 
important distinction in meanings for the word "theorem", I will adopt the following 
convention in this book: when "theorem" is capitalized, its meaning will be the everyday 
one-a Theorem is a statement in ordinary language which somebody once proved to be 
true by some sort of logic argument. When uncapitalized, "theorem" will have its 
technical meaning a string producible in some formal system. In these terms, the MU- 
puzzle asks whether MU is a theorem of the MlU-system. 

I gave you a theorem for free at the beginning, namely MI. Such "free" theorem is called 
an axiom-thc technical meaning again being qui different from the usual meaning. A 
formal system may have zero, or several, or even infinitely many axioms. Examples of all 
these types v appear in the book. 

Every formal system has symbol-shunting rules, such as the four rules of the MIU- 
system. These rules are called either rules of production or rules of inference. I will use 
both terms. 

The last term which I wish to introduce at this point is derivation. Shown below is a 
derivation of the theorem MUIIU: 

(1) MI axiom 

(2) Mil from (1) by rule II 

The MU-puzzle 


(3) Mill 


(5) MUIU 

from (2) by rule II 
from (3) by rule I 
from (4) by rule III 
from (5) by rule II 
from (6) by rule IV 


(7) MUIIU 

A derivation of a theorem is an explicit, line-by-line demonstration of how to produce 
that theorem according to the rules of the formal system. The concept of derivation is 
modeled on that of proof, but a derivation is an austere cousin of a proof. It would sound 
strange to say that you had proven MUIIU, but it does not sound so strange to say you 
have derived MUIIU. 

Most people go about the MU-puzzle by deriving a number of theorems, quite at random, 
just to see what kind of thing turns up. Pretty soon, they begin to notice some properties 
of the theorems they have made; that is where human intelligence enters the picture. For 
instance, it was probably not obvious to you that all theorems would begin with M, until 
you had tried a few. Then, the pattern emerged, and not only could you see the pattern, 
but you could understand it by looking at the rules, which have the property that they 
make each new theorem inherit its first letter from an earlier theorem; ultimately, then, all 
theorems' first letters can be traced back to the first letter of the sole axiom Ml-and that is 
a proof that theorems of the MlU-system must all begin with M. 

There is something very significant about what has happened here. It shows one 
difference between people and machines. It would certainly be possible-in fact it would 
be very easy-to program a computer to generate theorem after theorem of the MIU- 
system; and we could include in the program a command to stop only upon generating U. 
You now know that a computer so programmed would never stop. And this does not 
amaze you. But what if you asked a friend to try to generate U? It would not surprise you 
if he came back after a while, complaining that he can't get rid of the initial M, and 
therefore it is a wild goose chase. Even if a person is not very bright, he still cannot help 
making some observations about what he is doing, and these observations give him good 
insight into the task- insight which the computer program, as we have described it, lacks. 

Now let me be very explicit about what I meant by saying this shows a difference 
between people and machines. I meant that it is possible to program a machine to do a 
routine task in such a way that the machine will never notice even the most obvious facts 
about what it is doing; but it is inherent in human consciousness to notice some facts 
about the things one is doing. But you knew this all along. If you punch "1" into an 
adding machine, and then add 1 to it, and then add 1 again, and again, and again, and 
continue doing so for hours and hours, the machine will never learn to anticipate you, and 
do it itself, although any person would pick up the 

The MU-puzzle 44 

Inside and Outside the System 

pick up the idea, no matter how much or how well it is driven, that it i supposed to avoid 
other cars and obstacles on the road; and it will never learn even the most frequently 
traveled routes of its owner. 

The difference, then, is that it is possible for a machine to act unobservant; it is 
impossible for a human to act unobservant. Notice I am not saying that all machines are 
necessarily incapable of making sophisticated observations; just that some machines are. 
Nor am I saying that all people are always making sophisticated observations; people, in 
fact, are often very unobservant. But machines can be made to be totally unobservant; 
any people cannot. And in fact, most machines made so far are pretty close ti being 
totally unobservant. Probably for this reason, the property of being; unobservant seems to 
be the characteristic feature of machines, to most people. For example, if somebody says 
that some task is "mechanical", i does not mean that people are incapable of doing the 
task; it implies though, that only a machine could do it over and over without eve 
complaining, or feeling bored. 

Jumping out of the System 

It is an inherent property of intelligence that it can jump out of the tas which it is 
performing, and survey what it has done; it is always looking for and often finding, 
patterns. Now I said that an intelligence can jump out o its task, but that does not mean 
that it always will. However, a little prompting will often suffice. For example, a human 
being who is reading a boo may grow sleepy. Instead of continuing to read until the book 
is finished he is just as likely to put the book aside and turn off the light. He ha stepped 
"out of the system" and yet it seems the most natural thing in the world to us. Or, suppose 
person A is watching television when person B comes in the room, and shows evident 
displeasure with the situation Person A may think he understands the problem, and try to 
remedy it b exiting the present system (that television program), and flipping the channel 
knob, looking for a better show. Person B may have a more radio concept of what it is to 
"exit the system" -namely to turn the television oft Of course, there are cases where only a 
rare individual will have the vision to perceive a system which governs many peoples 
lives, a system which ha never before even been recognized as a system; then such people 
often devote their lives to convincing other people that the system really is there and that 
it ought to be exited from! 

How well have computers been taught to jump out of the system? I w cite one 
example which surprised some observers. In a computer chess: tournament not long ago 
in Canada, one program-the weakest of all the competing ones-had the unusual feature of 
quitting long before the game was over. It was not a very good chess player, but it at least 
had the redeeming quality of being able to spot a hopeless position, and to resign then 
and there, instead of waiting for the other program to go through the 

The MU-puzzle 


boring ritual of checkmating. Although it lost every game it played, it did it in style. A lot 
of local chess experts were impressed. Thus, if you define "the system" as "making 
moves in a chess game", it is clear that this program had a sophisticated, preprogrammed 
ability to exit from the system. On the other hand, if you think of "the system" as being 
"whatever the computer had been programmed to do", then there is no doubt that the 
computer had no ability whatsoever to exit from that system. 

It is very important when studying formal systems to distinguish working within 
the system from making statements or observations about the system. I assume that you 
began the MU-puzzle, as do most people, by working within the system; and that you 
then gradually started getting anxious, and this anxiety finally built up to the point where 
without any need for further consideration, you exited from the system, trying to take 
stock of what you had produced, and wondering why it was that you had not succeeded in 
producing MU. Perhaps you found a reason why you could not produce MU; that is 
thinking about the system. Perhaps you produced MIU somewhere along the way; that is 
working within the system. Now I do not want to make it sound as if the two modes are 
entirely incompatible; I am sure that every human being is capable to some extent of 
working inside a system and simultaneously thinking about what he is doing. Actually, in 
human affairs, it is often next to impossible to break things neatly up into "inside the 
system" and "outside the system"; life is composed of so many interlocking and 
interwoven and often inconsistent "systems" that it may seem simplistic to think of things 
in those terms. But it is often important to formulate simple ideas very clearly so that one 
can use them as models in thinking about more complex ideas. And that is why I am 
showing you formal systems; and it is about time we went back to discussing the MIU- 

M-Mode, I-Mode, U-Mode 

The MU-puzzle was stated in such a way that it encouraged some amount of exploration 
within the MlU-system-deriving theorems. But it was also stated in a way so as not to 
imply that staying inside the system would necessarily yield fruit. Therefore it 
encouraged some oscillation between the two modes of work. One way to separate these 
two modes would be to have two sheets of paper; on one sheet, you work "in your 
capacity as a machine", thus filling it with nothing but M's, I's, and U's; on the second 
sheet, you work "in your capacity as a thinking being", and are allowed to do whatever 
your intelligence suggests-which might involve using English, sketching ideas, working 
backwards, using shorthand (such as the letter V), compressing several steps into one, 
modifying the rules of the system to see what that gives, or whatever else you might 
dream up. One thing you might do is notice that the numbers 3 and 2 play an important 
role, since I's are gotten rid of in three's, and U's in two's-and doubling of length (except 
for the M) is allowed by rule II. So the second sheet might 

The MU-puzzle 


also have some figuring on it. We will occasionally refer back to these two modes of 
dealing with a formal system, and we will call them the Mechanic mode (M-mode) and 
the Intelligent mode (I-mode). To round out our mode with one for each letter of the 
MlU-system, I will also mention a fin mode-the Un-mode (U-mode), which is the Zen 
way of approaching thing. More about this in a few Chapters. 

Decision Procedures 

An observation about this puzzle is that it involves rules of two opposite tendencies-the 
lengthening rules and the shortening rules. Two rules (I and II) allow you to increase the 
size of strings (but only in very rigid, pr scribed ways, of course); and two others allow 
you to shrink strings somewhat (again in very rigid ways). There seems to be an endless 
variety to the order in which these different types of rules might be applied, and this gives 
hope that one way or another, MU could be produced. It might involve lengthening the 
string to some gigantic size, and then extracting piece after piece until only two symbols 
are left; or, worse yet, it might involve successive stages of lengthening and then 
shortening and then lengthening and then shortening, and so on. But there is no guarantee 
it. As a matter of fact, we already observed that U cannot be produced at all and it will 
make no difference if you lengthen and shorten till kingdom come. 

Still, the case of U and the case of MU seem quite different. It is by very 
superficial feature of U that we recognize the impossibility of producing it: it doesn't 
begin with an M (whereas all theorems must). It is very convenient to have such a simple 
way to detect nontheorems. However who says that that test will detect all nontheorems? 
There may be lots strings which begin with M but are not producible. Maybe MU is one 
of them. That would mean that the "first-letter test" is of limited usefulness able only to 
detect a portion of the nontheorems, but missing others. B there remains the possibility of 
some more elaborate test which discriminates perfectly between those strings which can 
be produced by the rules and those which cannot. Here we have to face the question, 
"What do mean by a test?" It may not be obvious why that question makes sense, of 
important, in this context. But I will give an example of a "test" which somehow seems to 
violate the spirit of the word. 

Imagine a genie who has all the time in the world, and who enjoys using it to 
produce theorems of the MlU-system, in a rather methodical way. Here, for instance, is a 
possible way the genie might go about it 

Step 1: Apply every applicable rule to the axiom MI. This yields two new theorems 
MIU, Mil. 

Step 2: Apply every applicable rule to the theorems produced in step 1. This yields 
three new theorems: MIIU, MIUIU, MIIII. 

The MU-puzzle 


Step 3: Apply every applicable rule to the theorems produced in step 2. This yields 

This method produces every single theorem sooner or later, because the rules are applied 
in every conceivable order. (See Fig. 11.) All of the lengthening-shortening alternations 
which we mentioned above eventually get carried out. However, it is not clear how long 
to wait for a given string 

miuiu MIIU MUD 


/ / /-7\ ^7/l\\\ l\ \ 


FIGURE 11. A systematically constructed "tree" of all the theorems of the MlU-system. 
The N th level down contains those theorems whose derivations contain exactly N steps. 
The encircled numbers tell which rule was employed. Is MU anywhere in this tree? 

to appear on this list, since theorems are listed according to the shortness of their 
derivations. This is not a very useful order, if you are interested in a specific string (such 
as MU), and you don't even know if it has any derivation, much less how long that 
derivation might be. 

Now we state the proposed "theoremhood-test": 

Wait until the string in question is produced; when that happens, you know it 
is a theorem-and if it never happens, you know that it is not a theorem. 

This seems ridiculous, because it presupposes that we don't mind waiting around literally 
an infinite length of time for our answer. This gets to the crux of the matter of what 
should count as a "test". Of prime importance is a guarantee that we will get our answer 
in a finite length of time. If there is a test for theoremhood, a test which does always 
terminate in a finite 

The MU-puzzle 


amount of time, then that test is called a decision procedure for the given formal system. 

When you have a decision procedure, then you have a very concrete 
characterization of the nature of all theorems in the system. Offhand, it might seem that 
the rules and axioms of the formal system provide no less complete a characterization of 
the theorems of the system than a decision procedure would. The tricky word here is 
"characterization". Certainly the rules of inference and the axioms of the MlU-system do 
characterize, implicitly, those strings that are theorems. Even more implicitly, they 
characterize those strings that are not theorems. But implicit characterization is not 
enough, for many purposes. If someone claims to have a characterization of all theorems, 
but it takes him infinitely long to deduce that some particular string is not a theorem, you 
would probably tend to say that there is something lacking in that characterization-it is 
not quite concrete enough. And that is why discovering that a decision procedure exists is 
a very important step. What the discovery means, in effect, is that you can perform a test 
for theoremhood of a string, and that, even if the test is complicated, it is guaranteed to 
terminate. In principle, the test is just as easy, just as mechanical, just as finite, just as full 
of certitude, as checking whether the first letter of the string is M. A decision procedure 
is a "litmus test" for theoremhood! 

Incidentally, one requirement on formal systems is that the set of axioms must be 
characterized by a decision procedure -there must be a litmus test for axiomhood. This 
ensures that there is no problem in getting off the ground at the beginning, at least. That 
is the difference between the set of axioms and the set of theorems: the former always has 
a decision procedure, but the latter may not. 

I am sure you will agree that when you looked at the MlU-system for the first 
time, you had to face this problem exactly. The lone axiom was known, the rules of 
inference were simple, so the theorems had been implicitly characterized-and yet it was 
still quite unclear what the consequences of that characterization were. In particular, it 
was still totally unclear whether MU is, or is not, a theorem. 

The MU-puzzle 


The MU-puzzle 


Two-Part Invention 


What the Tortoise Said to Achilles 

by Lewis Carroll' 

Achilles had overtaken the Tortoise, and had seated himself comfortably on its back. 

"So you've got to the end of our race-course?" said the Tortoise. "Even though it 
DOES consist of an infinite series of distances? I thought some wiseacre or other had 
proved that the thing couldn't be done?" 

"It CAN be done," said Achilles. "It HAS been done! Solvitur ambulando. You see the 
distances were constantly DIMINISHING; and so-" 

"But if they had been constantly INCREASING?" the Tortoise interrupted. "How 

"Then I shouldn't be here," Achilles modestly replied; "and You would have got 
several times round the world, by this time!" 

"You flatter me-FLATTEN, I mean," said the Tortoise; "for you ARE a heavy weight, 
and NO mistake! Well now, would you like to hear of a race-course, that most people 
fancy they can get to the end of in two or three steps, while it REALLY consists of an 
infinite number of distances, each one longer than the previous one?" 

"Very much indeed!" said the Grecian warrior, as he drew from his helmet (few 
Grecian warriors possessed POCKETS in those days) an enormous note-book and pencil. 
"Proceed! And speak SLOWLY, please! SHORTHAND isn't invented yet!" 

"That beautiful First Proposition by Euclid!" the Tortoise murmured dreamily. "You 
admire Euclid?" 

"Passionately! So far, at least, as one CAN admire a treatise that won't be published 
for some centuries to come!" 

"Well, now, let's take a little bit of the argument in that First Proposition just TWO 
steps, and the conclusion drawn from them. Kindly enter them in your note -book. And in 
order to refer to them conveniently, let's call them A, B, and Z: 

(A) Things that are equal to the same are equal to each other. 

(B) The two sides of this Triangle are things that are equal to the same. 
(Z) The two sides of this Triangle are equal to each other. 

Readers of Euclid will grant, I suppose, that Z follows logically from A and B, so that 
any one who accepts A and B as true, MUST accept Z as true?" 

"Undoubtedly! The youngest child in a High School-as soon as High 

Two-Part Invention 


Schools are invented, which will not be till some two thousand years later-will grant 

"And if some reader had NOT yet accepted A and B as true, he might still accept the 
SEQUENCE as a VALID one, I suppose?" 

"No doubt such a reader might exist. He might say, T accept as true the Hypothetical 
Proposition that, IF A and B be true, Z must be true; but I DON'T accept A and B as true.' 
Such a reader would do wisely in abandoning Euclid, and taking to football." 

"And might there not ALSO be some reader who would say T accept A and B as true, 
but I DON'T accept the Hypothetical'?" 

"Certainly there might. HE, also, had better take to football." 

"And NEITHER of these readers," the Tortoise continued, "is AS YET under any 
logical necessity to accept Z as true?" 
"Quite so," Achilles assented. 

"Well, now, I want you to consider ME as a reader of the SECOND kind, and to force 
me, logically, to accept Z as true." 

"A tortoise playing football would be-" Achilles was beginning. 

x -an anomaly, of course," the Tortoise hastily interrupted. "Don't wander from the 
point. Let's have Z first, and football afterwards!" 

"I'm to force you to accept Z, am I?" Achilles said musingly. "And your present 
position is that you accept A and B, but you DON'T accept the Hypothetical-" 

"Let's call it C," said the Tortoise. 

"-but you DON'T accept 

(C) If A and B are true, Z must be true." 

"That is my present position," said the Tortoise. 
"Then I must ask you to accept C." 

"I'll do so," said the Tortoise, "as soon as you've entered it in that notebook of yours. 
What else have you got in it?" 

"Only a few memoranda," said Achilles, nervously fluttering the leaves: "a few 
memoranda of-of the battles in which I have distinguished myself! " 

"Plenty of blank leaves, I see!" the Tortoise cheerily remarked. "We shall need them 
ALL!" (Achilles shuddered.) "Now write as I dictate: 

(A) Things that are equal to the same are equal to each other. 

(B) The two sides of this Triangle are things that are equal to the same. 

(C) If A and B are true, Z must be true. 

(Z) The two sides of this Triangle are equal to each other." 

"You should call it D, not Z," said Achilles. "It comes NEXT to the other three. If you 
accept A and B and C, you MUST accept Z. 

Two-Part Invention 


"And why must I?" 

"Because it follows LOGICALLY from them. If A and B and C are true, Z MUST be 
true. You can't dispute THAT, I imagine?" 

"If A and B and C are true, Z MUST be true," the Tortoise thoughtfully repeated. 
"That's ANOTHER Hypothetical, isn't it? And, if I failed to see its truth, I might accept A 
and B and C, and STILL not accept Z, mightn't I?" 

"You might," the candid hero admitted; "though such obtuseness would certainly be 
phenomenal. Still, the event is POSSIBLE. So I must ask you to grant ONE more 

"Very good, I'm quite willing to grant it, as soon as you've written it down. We will 
call it 

(D) If A and B and C are true, Z must be true. 

Have you entered that in your note -book?" 

"I HAVE!" Achilles joyfully exclaimed, as he ran the pencil into its sheath. "And at 
last we've got to the end of this ideal race-course! Now that you accept A and B and C 
and D, OF COURSE you accept Z." 

"Do I?" said the Tortoise innocently. "Let's make that quite clear. I accept A and B and 
C and D. Suppose I STILL refused to accept Z?" 

"Then Logic would take you by the throat, and FORCE you to do it!" Achilles 
triumphantly replied. "Logic would tell you, "You can't help yourself. Now that you've 
accepted A and B and C and D, you MUST accept Z!' So you've no choice, you see.", 

"Whatever LOGIC is good enough to tell me is worth WRITING DOWN," said the 
Tortoise. "So enter it in your book, please. We will call it 

(E) If A and B and C and D are true, Z must be true. 

Until I've granted THAT, of course I needn't grant Z. So it's quite a NECESSARY 
step, you see?" 

"I see," said Achilles; and there was a touch of sadness in his tone. 

Here the narrator, having pressing business at the Bank, was obliged to leave the 
happy pair, and did not again pass the spot until some months afterwards. When he did 
so, Achilles was still seated on the back of the much-enduring Tortoise, and was writing 
in his notebook, which appeared to be nearly full. The Tortoise was saying, "Have you 
got that last step written down? Unless I've lost count, that makes a thousand and one. 
There are several millions more to come. And WOULD you mind, as a personal favour, 
considering what a lot of instruction this colloquy of ours will provide for the Logicians 
of the Nineteenth Century- WOULD you mind adopting a pun that my cousin the Mock- 
Turtle will then make, and allowing yourself to be renamed TAUGHT-US?" 

"As you please," replied the weary warrior, in the hollow tones of despair, as he buried 
his face in his hands. "Provided that YOU, for YOUR part, will adopt a pun the Mock- 
Turtle never made, and allow yourself to be re-named A KILL-EASE!" 

Two-Part Invention 



Meaning and Form 
in Mathematics. 

THIS Two-Part Invention was the inspiration for my two characters. Just as Lewis 
Carroll took liberties with Zeno's Tortoise and Achilles, so have I taken liberties with 
Lewis Carroll's Tortoise and Achilles. In Carroll's dialogue, the same events take place 
over and over again, only each time on a higher and higher level; it is a wonderful 
analogue to Bach's Ever-Rising Canon. The Carrollian Dialogue, with its wit subtracted 
out, still leaves a deep philosophical problem: Do words and thoughts follow formal 
rules, or do they noft That problem is the problem of this book. 

In this Chapter and the next, we will look at several new formal systems. This will give 
us a much wider perspective on the concept of formal system. By the end of these two 
Chapters, you should have quite a good idea of the power of formal systems, and why 
they are of interest to mathematicians and logicians. 

The pq-System 

The formal system of this Chapter is called the pq-system. It is not important to 
mathematicians or logicians-in fact, it is just a simple invention of mine. Its importance 
lies only in the fact that it provides an excellent example of many ideas that play a large 
role in this book. There are three distinct symbols of the pq-system: 

p q - 

-the letters p, q, and the hyphen. 

The pq-system has an infinite number of axioms. Since we can't write them all down, we 
have to have some other way of describing what they are. Actually, we want more than 
just a description of the axioms; we want a way to tell whether some given string is an 
axiom or not. A mere description of axioms might characterize them fully and yet 
weakly-which was the problem with the way theorems in the MlU-system were 
characterized. We don't want to have to struggle for an indeterminate-possibly infinite 
length of time, just to find out if some string is an axiom or not. Therefore, we will define 
axioms in such a way that there is an obvious decision procedure for axiomhood of a 
string composed of p's, q's, and hyphens. 

Meaning and Form in Mathematics 


DEFINITION: xp-qx is an axiom, whenever x is composed of hyphens only. 

Note that 'x' must stand for the same string of hyphens in both occurrences For example, - 
-p-q — is an axiom. The literal expression 'xp-qx-' i„ not an axiom, of course (because V 
does not belong to the pq-system); it is more like a mold in which all axioms are cast-and 
it is called an axiom schema. 

The pq-system has only one rule of production: 

RULE: Suppose x, y, and z all stand for particular strings containing only hyphens. And 
suppose that x py qz is known to be a theorem. The' xpy-qz- is a theorem. 

For example, take x to be'--', y to be' — ', and z to be'-'. The rule tells us: 

If ~p — q- turns out to be a theorem, then so will ~p — q~. 

As is typical of rules of production, the statement establishes a causal connection between 
the theoremhood of two strings, but without asserting theoremhood for either one on its 

A most useful exercise for you is to find a decision procedure for the theorems of 
the pq-system. It is not hard; if you play around for a while you will probably pick it up. 
Try it. 

The Decision Procedure 

I presume you have tried it. First of all, though it may seem too obvious to mention, I 
would like to point out that every theorem of the pq-system has three separate groups of 
hyphens, and the separating elements are one p, and one q, in that order. (This can be 
shown by an argument based on "heredity", just the way one could show that all MIU- 
system theorems had to begin with M.) This means that we can rule out, from its form 
alone, o string such as ~p~p~p— q . 

Now, stressing the phrase "from its form alone" may seem silly; what else is there to a 
string except its form? What else could possibly play a roll in determining its properties? 
Clearly nothing could. But bear this in mint as the discussion of formal systems goes on; 
the notion of "form" will star to get rather more complicated and abstract, and we will 
have to think more about the meaning of the word "form". In any case, let us give the 
name well formed string to any string which begins with a hyphen-group, then ha one p, 
then has a second hyphen-group, then a q, and then a final hyphen-group. 
Back to the decision procedure ... The criterion for theoremhood is that the first two 
hyphen-groups should add up, in length, to the third 

Meaning and Form in Mathematics 


hyphen-group, for instance, ~p~q - is a theorem, since 2 plus 2 equals 4, whereas — p— q- 
is not, since 2 plus 2 is not 1. To see why this is the proper criterion, look first at the 
axiom schema. Obviously, it only manufactures axioms which satisfy the addition 
criterion. Second, look at the rule of production. If the first string satisfies the addition 
criterion, so must the second one-and conversely, if the first string does not satisfy the 
addition criterion, then neither does the second string. The rule makes the addition 
criterion into a hereditary property of theorems: any theorem passes the property on to its 
offspring. This shows why the addition criterion is correct. 

There is, incidentally, a fact about the pq-system which would enable us to say 
with confidence that it has a decision procedure, even before finding the addition 
criterion. That fact is that the pq-system is not complicated by the opposing currents of 
lengthening and shortening rules; it has only lengthening rules. Any formal system which 
tells you how to make longer theorems from shorter ones, but never the reverse, has got 
to have a decision procedure for its theorems. For suppose you are given a string. First 
check whether it's an axiom or not (I am assuming that there is a decision procedure for 
axiomhood-otherwise, things are hopeless). If it is an axiom, then it is by definition a 
theorem, and the test is over. So suppose instead that it's not an axiom. Then, to be a 
theorem, it must have come from a shorter string, via one of the rules. By going over the 
various rules one by one, you can pinpoint not only the rules that could conceivably 
produce that string, but also exactly which shorter strings could be its forebears on the 
"family tree". In this way, you "reduce" the problem to determining whether any of 
several new but shorter strings is a theorem. Each of them can in turn be subjected to the 
same test. The worst that can happen is a proliferation of more and more, but shorter and 
shorter, strings to test. As you continue inching your way backwards in this fashion, you 
must be getting closer to the source of all theorems-the axiom schemata. You just can't 
get shorter and shorter indefinitely; therefore, eventually either you will find that one of 
your short strings is an axiom, or you'll come to a point where you're stuck, in that none 
of your short strings is an axiom, and none of them can be further shortened by running 
some rule or other backwards. This points out that there really is not much deep interest 
in formal systems with lengthening rules only; it is the interplay of lengthening and 
shortening rules that gives formal systems a certain fascination.. 

Bottom-up vs. Top-down 

The method above might be called a top-down decision procedure, to be contrasted with a 
bottom-up decision procedure, which I give now. It is very reminiscent of the genie's 
systematic theorem-generating method for the MlU-system, but is complicated by the 
presence of an axiom schema. We are going to form a "bucket" into which we throw 
theorems as they are generated. Here is how it is done: 

Meaning and Form in Mathematics 


(la) Throw the simplest possible axiom (-p-q~) into the bucket. 

(I b) Apply the rule of inference to the item in the bucket, and put the result into the 

(2a) Throw the second-simplest axiom into the bucket. 

(2b) Apply the rule to each item in the bucket, and throw all results into the bucket. 
(3 a) Throw the third-simplest axiom into the bucket. 

(3b) Apply the rule to each item in the bucket, and throw all results into the bucket, 
etc., etc. 

A moment's reflection will show that you can't fail to produce every theorem of the pq- 
system this way. Moreover, the bucket is getting filled with longer and longer theorems, 
as time goes on. It is again a consequence of that lack of shortening rules. So if you have 
a particular string, such as — p — q — , which you want to test for theoremhood, just 
follow the numbered steps, checking all the while for the string in question. If it turns up- 
theorem! If at some point everything that goes into the bucket is longer than the string in 
question, forget it-it is not a theorem. This decision procedure is bottom=up because it is 
working its way up from the basics, which is to say the axioms. The previous decision 
procedure is top-down because it does precisely the reverse: it works its way back down 
towards the basics. 

Isomorphisms Induce Meaning 

Now we come to a central issue of this Chapter-indeed of the book. Perhaps you have 
already thought to yourself that the pq-theorems are like additions. The string ~p — q — is 
a theorem because 2 plus 3 equals 5. It could even occur to you that the theorem — p — q~ 
is a statement, written in an odd notation, whose meaning is that 2 plus 3 is 5. Is this a 
reasonable way to look at things? Well, I deliberately chose 'p' to remind you of 'plus', 
and 'q' to remind you of 'equals' ... So, does the string — p — q — actually mean "2 plus 
3 equals 5"? 

What would make us feel that way? My answer would be that we have perceived 
an isomorphism between pq-theorems and additions. In the Introduction, the word 
"isomorphism" was defined as an information preserving transformation. We can now go 
into that notion a little more deeply, and see it from another perspective. The word 
"isomorphism' applies when two complex structures can be mapped onto each other, in 
such a way that to each part of one structure there is a corresponding part in the other 
structure, where "corresponding" means that the two part play similar roles in their 
respective structures. This usage of the word "isomorphism" is derived from a more 
precise notion in mathematics. 

Meaning and Form in Mathematics 


It is cause for joy when a mathematician discovers an isomorphism between two 
structures which he knows. It is often a "bolt from the blue", and a source of 
wonderment. The perception of an isomorphism between two known structures is a 
significant advance in knowledge-and I claim that it is such perceptions of isomorphism 
which create meanings in the minds of people. A final word on the perception of 
isomorphisms: since they come in many shapes and sizes, figuratively speaking, it is not 
always totally clear when you really have found an isomorphism. Thus, "isomorphism" is 
a word with all the usual vagueness of words- which is a defect but an advantage as well. 

In this case, we have an excellent prototype for the concept of isomorphism. 
There is a "lower level" of our isomorphism-that is, a mapping between the parts of the 
two structures: 

p <= => plus 
q <= => equals 

- <= => one 

— <= => two 
— - <= => three 


This symbol-word correspondence has a name: interpretation. 

Secondly, on a higher level, there is the correspondence between true statements 
and theorems. But-note carefully-this higher-level correspondence could not be perceived 
without the prior choice of an interpretation for the symbols. Thus it would be more 
accurate to describe it as a correspondence between true statements and interpreted 
theorems. In any case we have displayed a two-tiered correspondence, which is typical of 
all isomorphisms. 

When you confront a formal system you know nothing of, and if you hope to 
discover some hidden meaning in it, your problem is how to assign interpretations to its 
symbols in a meaningful way-that is, in such a way that a higher-level correspondence 
emerges between true statements and theorems. You may make several tentative stabs in 
the dark before finding a good set of words to associate with the symbols. It is very 
similar to attempts to crack a code, or to decipher inscriptions in an unknown language 
like Linear B of Crete: the only way to proceed is by trial and error, based on educated 
guesses. When you hit a good choice, a "meaningful" choice, all of a sudden things just 
feel right, and work speeds up enormously. Pretty soon everything falls into place. The 
excitement of such an experience is captured in The Decipherment of Linear B by John 

But it is uncommon, to say the least, for someone to be in the position of 
"decoding" a formal system turned up in the excavations of a ruined civilization! 
Mathematicians (and more recently, linguists, philosophers, and some others) are the only 
users of formal systems, and they invariably have an interpretation in mind for the formal 
systems which they use and publish. The idea of these people is to set up a formal system 

Meaning and Form in Mathematics 


Theorems reflect some portion of reality isomorphically. In such a case, the choice of 
symbols is a highly motivated one, as is the choice of typographical rules of production. 
When I devised the pq-system, I was in position. You see why I chose the symbols I 
chose. It is no accident theorems are isomorphic to additions; it happened because I 
deliberately sought out a way to reflect additions typographically. 

Meaningless and Meaningful Interpretations 

You can choose interpretations other than the one I chose. You need make every 
theorem come out true. But there would be very little reason make an interpretation in 
which, say, all theorems came out false, certainly even less reason to make an 
interpretation under which there is no correlation at all, positive or negative, between 
theoremhood and tri Let us therefore make a distinction between two types of 
interpretations a formal system. First, we can have a meaningless interpretation, one un 
which we fail to see any isomorphic connection between theorems of system, and reality. 
Such interpretations abound-any random choice a will do. For instance, take this one: 

p <= => horse 
q <= => happy 
- <= => apple 

Now -p-q~ acquires a new interpretation: "apple horse apple hat apple apple" -a 
poetic sentiment, which might appeal to horses, and mi! even lead them to favor this 
mode of interpreting pq-strings! However, t interpretation has very little 
"meaningfulness"; under interpretative, theorems don't sound any truer, or any better, 
than nontheorems. A ho might enjoy "happy happy happy apple horse" (mapped onto q q 
q) just as much as any interpreted theorem. 

The other kind of interpretation will be called meaningful. Under si an 
interpretation, theorems and truths correspond-that is, an isomorphism exists between 
theorems and some portion of reality. That is why it is good to distinguish between 
interpretations and meanings. Any old word can be used as an interpretation for p', but 
'plus' is the only meaningful choice we've come up with. In summary, the meaning of "p' 
seems to be 'plus' though it can have a million different interpretations. 

Active vs. Passive Meanings 

Probably the most significant fact of this Chapter, if understood deeply this: the pq- 
system seems to force us into recognizing that symbols of a formal system, though 
initially without meaning, cannot avoid taking on "meaning" of sorts at least if an 
isomorphism is found. The difference between meaning it formal system and in a 
language is a very important one, however. It is this: 

Meaning and Form in Mathematics 


in a language, when we have learned a meaning for a word, we then mar-c new 
statements based on the meaning of the word. In a sense the meaning becomes active, 
since it brings into being a new rule for creating sentences. This means that our command 
of language is not like a finished product: the rules for making sentences increase when 
we learn new meanings. On the other hand, in a formal system, the theorems are 
predefined, by the rules of production. We can choose "meanings" based on an 
isomorphism (if we can find one) between theorems and true statements. But this does 
not give us the license to go out and add new theorems to the established theorems. That 
is what the Requirement of Formality in Chapter I was warning you of. 

In the MlU-system, of course, there was no temptation to go beyond the four 
rules, because no interpretation was sought or found. But here, in our new system, one 
might be seduced by the newly found "meaning" of each symbol into thinking that the 


is a theorem. At least, one might wish that this string were a theorem. But wishing doesn't 
change the fact that it isn't. And it would be a serious mistake to think that it "must" be a 
theorem, just because 2 plus 2 plus 2 plus 2 equals 8. It would even be misleading to 
attribute it any meaning at all, since it is not well-formed, and our meaningful 
interpretation is entirely derived from looking at well-formed strings. 

In a formal system, the meaning must remain passive; we can read each string 
according to the meanings of its constituent symbols, but we do not have the right to 
create new theorems purely on the basis of the meanings we've assigned the symbols. 
Interpreted formal systems straddle the line between systems without meaning, and 
systems with meaning. Their strings can be thought of as "expressing" things, but this 
must come only as a consequence of the formal properties of the system. 

Double-Entendre ! 

And now, I want to destroy any illusion about having found the meanings for the symbols 
of the pq-system. Consider the following association: 

p <= => equals 

q <= => taken from 

- <= => one 

— <= => two 


Now, ~p — q — has a new interpretation: "2 equals 3 taken from 5". Of course it is a true 
statement. All theorems will come out true under this new interpretation. It is just as 
meaningful as the old one. Obviously, it is silly to ask, "But which one is the meaning of 
the string?" An interpreta 

Meaning and Form in Mathematics 


tion will me meaningful to the extent that it accurately reflects some isomorphism to the 
real world. When different aspects of the real world a isomorphic to each other (in this 
case, additions and subtractions), or single formal system can be isomorphic to both, and 
therefore can take ( two passive meanings. This kind of double-valuedness of symbols at 
strings is an extremely important phenomenon. Here it seems trivial curious, annoying. 
But it will come back in deeper contexts and bring with it a great richness of ideas. 

Here is a summary of our observations about the pq-system. Und either of the two 
meaningful interpretations given, every well-form( string has a grammatical assertion for 
its counterpart-some are true, son false. The idea of well formed strings in any formal 
system is that they a those strings which, when interpreted symbol for symbol, yield 
grammatical sentences. (Of course, it depends on the interpretation, but usually, there one 
in mind.) Among the well-formed strings occur the theorems. The: are defined by an 
axiom schema, and a rule of production. My goal in inventing the pq-system was to 
imitate additions: I wanted every theorem] to express a true addition under interpretation; 
conversely, I wanted every true addition of precisely two positive integers to be 
translatable into a string, which would be a theorem. That goal was achieved. Notice, 
then fore, that all false additions, such as "2 plus 3 equals 6", are mapped into strings 
which are well-formed, but which are not theorems. 

Formal Systems and Reality 

This is our first example of 'a case where a formal system is based upon portion of 
reality, and seems to mimic it perfectly, in that its theorems a] isomorphic to truths about 
that part of reality. However, reality and tt formal system are independent. Nobody need 
be aware that there is a isomorphism between the two. Each side stands by itself-one plus 
or equals two, whether or not we know that -p-q~ is a theorem; and -p-q~ is still a 
theorem whether or not we connect it with addition. 

You might wonder whether making this formal system, or any form system, sheds 
new light on truths in the domain of its interpretation. Hat we learned any new additions 
by producing pq-theorems? Certainly not but we have learned something about the nature 
of addition as process-namely, that it is easily mimicked by a typographical rule 
governing meaningless symbols. This still should not be a big surprise sing addition is 
such a simple concept. It is a commonplace that addition can I captured in the spinning 
gears of a device like a cash register. 

But it is clear that we have hardly scratched the surface, as far formal systems go; 
it is natural to wonder about what portion of reality co be imitated in its behavior by a set 
of meaningless symbols governed I formal rules. Can all of reality be turned into a formal 
system? In a very broad sense, the answer might appear to be yes. One could suggest, for 
instance, that reality is itself nothing but one very complicated formal 

Meaning and Form in Mathematics 


system. Its symbols do not move around on paper, but rather in a three-dimensional 
vacuum (space); they are the elementary particles of which everything is composed. 
(Tacit assumption: that there is an end to the descending chain of matter, so that the 
expression "elementary particles" makes sense.) The "typographical rules" are the laws of 
physics, which tell how, given the positions and velocities of all particles at a given 
instant, to modify them, resulting in a new set of positions and velocities belonging to the 
"next" instant. So the theorems of this grand formal system are the possible 
configurations of particles at different times in the history of the universe. The sole axiom 
is (or perhaps, was) the original configuration of all the particles at the "beginning of 
time". This is so grandiose a conception, however, that it has only the most theoretical 
interest; and besides, quantum mechanics (and other parts of physics) casts at least some 
doubt on even the theoretical worth of this idea. Basically, we are asking if the universe 
operates deterministically, which is an open question. 

Mathematics and Symbol Manipulation 

Instead of dealing with such a big picture, let's limit ourselves to mathematics as 
our "real world". Here, a serious question arises: How can we be sure, if we've tried to 
model a formal system on some part of mathematics, that we've done the job accurately- 
especially if we're not one hundred per cent familiar with that portion of mathematics 
already? Suppose the goal of the formal system is to bring us new knowledge in that 
discipline. How will we know that the interpretation of every theorem is true, unless 
we've proven that the isomorphism is perfect? And how will we prove that the 
isomorphism is perfect, if we don't already know all about the truths in the discipline to 
begin with? 

Suppose that in an excavation somewhere, we actually did discover some 
mysterious formal system. We would try out various interpretations and perhaps 
eventually hit upon one which seemed to make every theorem come out true, and every 
nontheorem come out false. But this is something which we could only check directly in 
a finite number of cases. The set of theorems is most likely infinite. How will we know 
that all theorems express truths under this interpretation, unless we know everything there 
is to know about both the formal system and the corresponding domain of interpretation? 

It is in somewhat this odd position that we will find ourselves when we attempt to 
match the reality of natural numbers (i.e., the nonnegative integers: 0, 1, 2, ...) with the 
typographical symbols of a formal system. We will try to understand the relationship 
between what we call "truth" in number theory and what we can get at by symbol 

So let us briefly look at the basis for calling some statements of number theory 
true, and others false. How much is 12 times 12? Everyone knows it is 144. But how 
many of the people who give that answer have actually at 

Meaning and Form in Mathematics 


any time in their lives drawn a 12 by 12 rectangle, and then counted the little squares in 
it? Most people would regard the drawing and counting unnecessary. They would instead 
offer as proof a few marks on paper, such as are shown below: 

X 12 



And that would be the "proof. Nearly everyone believes that if you counted the 
squares, you would get 144 of them; few people feel that outcome is in doubt. 

The conflict between the two points of view comes into sharper focus when you 
consider the problem of determining the value 987654321 x 123456789. First of all, it is 
virtually impossible to construct the appropriate rectangle; and what is worse, even if it 
were constructed and huge armies of people spent centuries counting the little squares, o 
a very gullible person would be willing to believe their final answer. It is just too likely 
that somewhere, somehow, somebody bobbled just a little bit. So is it ever possible to 
know what the answer is? If you trust the symbolic process which involves manipulating 
digits according to certain simple rules, yes. That process is presented to children as a 
device which gets right answer; lost in the shuffle, for many children, are the rhyme 
reason of that process. The digit-shunting laws for multiplication are based mostly on a 
few properties of addition and multiplication which are assumed to hold for all numbers. 

The Basic Laws of Arithmetic 

The kind of assumption I mean is illustrated below. Suppose that you down a few sticks: 


Now you count them. At the same time, somebody else counts them, starting from the 
other end. Is it clear that the two of you will get the s: answer? The result of a counting 
process is independent of the way in which it is done. This is really an assumption about 
what counting i would be senseless to try to prove it, because it is so basic; either you s or 
you don't-but in the latter case, a proof won't help you a bit. 

From this kind of assumption, one can get to the commutativity and associativity 
of addition (i.e., first that b + c = c + b always, and second that b + (c + d) = (b + c) + d 
always). The same assumption can also you to the commutativity and associativity of 
multiplication; just think of 

Meaning and Form in Mathematics 


many cubes assembled to form a large rectangular solid. Multiplicative commutativity 
and associativity are just the assumptions that when you rotate the solid in various ways, 
the number of cubes will not change. Now these assumptions are not verifiable in all 
possible cases, because the number of such cases is infinite. We take them for granted; 
we believe them (if we ever think about them) as deeply as we could believe anything. 
The amount of money in our pocket will not change as we walk down the street, jostling 
it up and down; the number of books we have will not change if we pack them up in a 
box, load them into our car, drive one hundred miles, unload the box, unpack it, and place 
the books in a new shelf. All of this is part of what we mean by number. 

There are certain types of people who, as soon as some undeniable fact is written 
down, find it amusing to show why that "fact" is false after all. I am such a person, and as 
soon as I had written down the examples above involving sticks, money, and books, I 
invented situations in which they were wrong. You may have done the same. It goes to 
show that numbers as abstractions are really quite different from the everyday numbers 
which we use. 

People enjoy inventing slogans which violate basic arithmetic but which illustrate 
"deeper" truths, such as "1 and 1 make 1" (for lovers), or "1 plus 1 plus 1 equals 1" (the 
Trinity). You can easily pick holes in those slogans, showing why, for instance, using the 
plus-sign is inappropriate in both cases. But such cases proliferate. Two raindrops 
running down a windowpane merge; does one plus one make one? A cloud breaks up into 
two clouds-more evidence for the same? It is not at all easy to draw a sharp line between 
cases where what is happening could be called "addition", and where some other word is 
wanted. If you think about the question, you will probably come up with some criterion 
involving separation of the objects in space, and making sure each one is clearly 
distinguishable from all the others. But then how could one count ideas? Or the number 
of gases comprising the atmosphere? Somewhere, if you try to look it up, you can 
probably find a statement such as, "There are 17 languages in India, and 462 dialects." 
There is something strange about precise statements like that, when the concepts 
"language" and "dialect" are themselves fuzzy. 

Ideal Numbers 

Numbers as realities misbehave. However, there is an ancient and innate sense in 
people that numbers ought not to misbehave. There is something clean and pure in the 
abstract notion of number, removed from counting beads, dialects, or clouds; and there 
ought to be a way of talking about numbers without always having the silliness of reality 
come in and intrude. The hard-edged rules that govern "ideal" numbers constitute 
arithmetic, and their more advanced consequences constitute number theory. There is 
only one relevant question to be asked, in making the transition from numbers as 
practical things to numbers as formal things. Once you have 

Meaning and Form in Mathematics 


Meaning and Form in Mathematics 


decided to try to capsulize all of number theory in an ideal system, is it really possible to 
do the job completely? Are numbers so clean and crystalline and regular that their nature 
can be completely captured in the rules of a formal system? The picture Liberation (Fig. 
13), one of Escher's most beautiful, is a marvelous contrast between the formal and the 
informal, with a fascinating transition region. Are numbers really as free as birds? Do 
they suffer as much from being crystallized into a rule-obeying system? Is there a 
magical transition region between numbers in reality and numbers on paper? 

When I speak of the properties of natural numbers, I don't just mean properties 
such as the sum of a particular pair of integers. That can be found out by counting, and 
anybody who has grown up in this century cannot doubt the mechanizability of such 
processes as counting, adding, multiplying, and so on. I mean the kinds of properties 
which mathematicians are interested in exploring, questions for which no counting- 
process is sufficient to provide the answer-not even theoretically sufficient. Let us take a 
classic example of such a property of natural numbers. The statement is: "There are 
infinitely many prime numbers." First of all, there is no counting process which will ever 
be able to confirm, or refute, this assertion. The best we could do would be to count 
primes for a while and concede that there are "a lot". But no amount of counting alone 
would ever resolve the question of whether the number of primes is finite or infinite. 
There could always be more. The statement-and it is called "Euclid's Theorem" (notice 
the capital "T")-is quite unobvious. It may seem reasonable, or appealing, but it is not 
obvious. However, mathematicians since Euclid have always called it true. What is the 

Euclid's Proof 

The reason is that reasoning tells them it is so. Let us follow the reasoning involved. We 
will look at a variant of Euclid's proof. This proof works by showing that whatever 
number you pick, there is a prime larger than it. Pick a number-N. Multiply all the 
positive integers starting with 1 and ending with N; in other words, form the factorial of 
N, written "N!". What you get is divisible by every number up to N. When you add 1 to 
N!, the result 

can't be a multiple of 2 (because it leaves 1 over, when you divide 

by 2); 

can't be a multiple of 3 (because it leaves I over, when you divide 

by 3); 

can't be a multiple of 4 (because it leaves 1 over, when you divide 

by 4); 

Meaning and Form in Mathematics 


can't be a multiple of A" (because it leaves 1 over, when you 

divide by AO; 

In other words, N\ + 1 , if it is divisible at all (other than by 1 and itself only is 
divisible by numbers greater than N. So either it is itself prime, or prime divisors are 
greater than N. But in either case we've shown the must exist a prime above N. The 
process holds no matter what number is. Whatever N is, there is a prime greater than N. 
And thus ends the demonstration of the infinitude of the primes. 

This last step, incidentally, is called generalization, and we will meet again later 
in a more formal context. It is where we phrase an argument terms of a single number 
(AO, and then point out that A" was unspecified and therefore the argument is a general 

Euclid's proof is typical of what constitutes "real mathematics". It simple, 
compelling, and beautiful. It illustrates that by taking several rash short steps one can get 
a long way from one's starting point. In our case, t starting points are basic ideas about 
multiplication and division and forth. The short steps are the steps of reasoning. And 
though eve individual step of the reasoning seems obvious, the end result is not obvious. 
We can never check directly whether the statement is true or not; } we believe it, because 
we believe in reasoning. If you accept reasoning there seems to be no escape route; once 
you agree to hear Euclid out, you'll have to agree with his conclusion. That's most 
fortunate-because it mea that mathematicians will always agree on what statements to 
label "true and what statements to label "false". 

This proof exemplifies an orderly thought process. Each statement related to 
previous ones in an irresistible way. This is why it is called "proof rather than just "good 
evidence". In mathematics the goal always to give an ironclad proof for some unobvious 
statement. The very fact of the steps being linked together in an ironclad way suggests ti 
there may be a patterned structure binding these statements together. TI structure can 
best be exposed by finding a new vocabulary-a stylized vocabulary, consisting of 
symbols-suitable only for expressing statements about numbers. Then we can look at the 
proof as it exists in its translated version. It will be a set of statements which are related, 
line by line, in some detectable way. But the statements, since they're represented by 
means a small and stylized set of symbols, take on the aspect of patterns. In other words, 
though when read aloud, they seem to be statements about numb and their properties, still 
when looked at on paper, they seem to be abstract patterns-and the line-by-line structure 
of the proof may start to look like slow transformation of patterns according to some few 
typographical rules. 

Getting Around Infinity 

Although Euclid's proof is a proof that all numbers have a certain property it avoids 
treating each of the infinitely many cases separately. It gets around 

Meaning and Form in Mathematics 


it by using phrases like "whatever TV is", or "no matter what number TV is". We could also 
phrase-the proof over again, so that it uses the phrase "all N". By knowing the appropriate 
context and correct ways of using such phrases, we never have to deal with infinitely 
many statements. We deal with just two or three concepts, such as the word "all" -which, 
though themselves finite, embody an infinitude; and by using them, we sidestep the 
apparent problem that there are an infinite number of facts we want to prove. 

We use the word "all" in a few ways which are defined by the thought processes 
of reasoning. That is, there are rules which our usage of "all" obeys. We may be 
unconscious of them, and tend to claim we operate on the basis of the meaning of the 
word; but that, after all, is only a circumlocution for saying that we are guided by rules 
which we never make explicit. We have used words all our lives in certain patterns, and 
instead of calling the patterns "rules", we attribute the courses of our thought processes to 
the "meanings" of words. That discovery was a crucial recognition in the long path 
towards the formalization of number theory. 

If we were to delve into Euclid's proof more and more carefully, we would see 
that it is composed of many, many small-almost infinitesimal steps. If all those steps were 
written out line after line, the proof would appear incredibly complicated. To our minds it 
is clearest when several steps are telescoped together, to form one single sentence. If we 
tried to look at the proof in slow motion, we would begin to discern individual frames. In 
other words, the dissection can go only so far, and then we hit the "atomic" nature of 
reasoning processes. A proof can be broken down into a series of tiny but discontinuous 
jumps which seem to flow smoothly when perceived from a higher vantage point. In 
Chapter VIII, I will show one way of breaking the proof into atomic units, and you will 
see how incredibly many steps are involved. Perhaps it should not surprise you, though. 
The operations in Euclid's brain when he invented the proof must have involved millions 
of neurons (nerve cells), many of which fired several hundred times in a single second. 
The mere utterance of a sentence involves hundreds of thousands of neurons. If Euclid's 
thoughts were that complicated, it makes sense for his proof to contain a huge number of 
steps! (There may be little direct connection between the neural actions in his brain, and a 
proof in our formal system, but the complexities of the two are comparable. It is as if 
nature wants the complexity of the proof of the infinitude of primes to be conserved, even 
when the systems involved are very different from each other.) 

In Chapters to come, we will lay out a formal system that (1) includes a stylized 
vocabulary in which all statements about natural numbers can be expressed, and (2) has 
rules corresponding to all the types of reasoning which seem necessary. A very important 
question will be whether the rules for symbol manipulation which we have then 
formulated are really of equal power (as far as number theory is concerned) to our usual 
mental reasoning abilities-or, more generally, whether it is theoretically possible to attain 
the level of our thinking abilities, by using some formal system. 

Meaning and Form in Mathematics 



for Unaccompanied Achilles 

The telephone rings; Achilles picks it up. 

Achilles: Hello, this is Achilles. 
Achilles: Oh, hello, Mr. T. How are you? 

Achilles: A torticollis? Oh, I'm sorry to hear it. Do you have any idea what caused it? 
Achilles: How long did you hold it in that position? 

Achilles: Well, no wonder it's stiff, then. What on earth induced you keep your neck 

twisted that way for so long? 
Achilles: Wondrous many of them, eh? What kinds, for example? Achilles: What do you 

mean, "phantasmagorical beasts"? 

FIGURE 14. Mosaic II, by M. C. Escher (lithograph, 1957). 

Sonata for Unaccompanied Achilles 


Achilles: Wasn't it terrifying to see so many of them at the same time? Achilles: A 
guitar!? Of all things to be in the midst of all those weird creatures. Say, don't you 
play the guitar? 

Achilles: Oh, well, it's all the same to me. 

Achilles: You're right; I wonder why I never noticed that difference between fiddles and 
guitars before. Speaking of fiddling, how would you like to come over and listen 
to one of the sonatas for unaccompanied violin by your favorite composer, J. S. 
Bach? I just bought a marvelous recording of them. I still can't get over the way 
Bach uses a single violin to create a piece with such interest. 

Achilles: A headache too? That's a shame. Perhaps you should just go to bed. 

Achilles: I see. Have you tried counting sheep? 

Achilles: Oh, oh, I see. Yes, I fully know what you mean. Well, if it's THAT distracting, 

perhaps you'd better tell it to me, and let me try to work on it, too. 
Achilles: A word with the letters 'A', 'D', 'A', "C consecutively inside it ... Hmm ... 

What about "abracadabra"? 
Achilles: True, "ADAC" occurs backwards, not forwards, in that word. Achilles: Hours 

and hours? It sounds like I'm in for a long puzzle, then. Where did you hear this 

infernal riddle? 

Achilles: You mean he looked like he was meditating on esoteric Buddhist matters, but in 
reality he was just trying to think up complex word puzzles? 

Achilles: Aha! -the snail knew what this fellow was up to. But how did you come to talk 
to the snail? 

Achilles: Say, I once heard a word puzzle a little bit like this one. Do you want to hear it? 
Or would it just drive you further into distraction? Achilles: I agree-can't do any 
harm. Here it is: What's a word that begins with the letters "HE" and also ends 
with "HE"? 

Achilles: Very ingenious-but that's almost cheating. It's certainly not what I meant! 
Achilles: Of course you're right-it fulfills the conditions, but it's a sort of "degenerate" 

solution. There's another solution which I had in mind. Achilles: That's exactly it! 

How did you come up with it so fast? Achilles: So here's a case where having a 

headache actually might have helped you, rather than hindering you. Excellent! 

But I'm still in the dark on your "ADAC" puzzle. 
Achilles: Congratulations! Now maybe you'll be able to get to sleep! So tell me, what is 

the solution? 

Achilles: Well, normally I don't like hints, but all right. What's your hint? Achilles: I 
don't know what you mean by "figure" and "ground" in this case. 

Achilles: Certainly I know Mosaic II! I know ALL of Escher's works. After all, he's my 
favorite artist. In any case, I've got a print of Mosaic II hanging on my wall, in 
plain view from here. 

Sonata for Unaccompanied Achilles 


Achilles:: Yes, t see all the black animals. 

Achilles: Yes, I also see how their "negative space" — what's left out— defines the white 

Achilles: So THAT'S what you mean by "figure" and "ground". But what does that have 

to do with the "AD AC" puzzle? 
Achilles: Oh, this is too tricky for me. I think I'M starting to get a headache 
Achilles: You want to come over now? But I thought- 
Achilles: Very well. Perhaps by then I'll have thought of the right answer to YOUR 

puzzle, using your figure-ground hint, relating it to MY puzzle 
Achilles: I'd love to play them for you. 
Achilles: You've invented a theory about them? 
Achilles: Accompanied by what instrument? 

Achilles: Well, if that's the case, it seems a little strange that he would have written out 

the harpsichord part, then, and had it published a s well. 
Achilles: I see — sort of an optional feature. One could listen to them either way — with 

or without accompaniment. But how would one know what the accompaniment is 

supposed to sound like? 
Achilles: Ah, yes, I guess that it is best, after all, to leave it to the listener's imagination. 

And perhaps, as you said, Bach never even had accompaniment in mind at all. 

Those sonatas seem to work very indeed as they are. 
Achilles: Right. Well, I'll see you shortly. 
Achilles: Good-bye, Mr. T. 

Sonata for Unaccompanied Achilles 



Figure and Ground 

Primes vs. Composites 

THERE IS A strangeness to the idea that concepts can be captured by simple 
typographical manipulations. The one concept so far captured is that of addition, and it 
may not have appeared very strange. But suppose the goal were to create a formal system 
with theorems of the form Px, the letter V standing for a hyphen-string, and where the 
only such theorems would be ones in which the hyphen-string contained exactly a prime 
number of hyphens. Thus, P — would be a theorem, but P — would not. How could this 
be done typographically? First, it is important to specify clearly what is meant by 
typographical operations. The complete repertoire has been presented in the MlU-system 
and the pq-system, so we really only need to make a list of the kinds of things we have 

(1) reading and recognizing any of a finite set of symbols; 

(2) writing down any symbol belonging to that set; 

(3) copying any of those symbols from one place to another; 

(4) erasing any of those symbols; 

(5) checking to see whether one symbol is the same as another; 

(6) keeping and using a list of previously generated theorems. 

The list is a little redundant, but no matter. What is important is that it clearly involves 
only trivial abilities, each of them far less than the ability to distinguish primes from 
nonprimes. How, then, could we compound some of these operations to make a formal 
system in which primes are distinguished from composite numbers? 

The tq-System 

A first step might be to try to solve a simpler, but related, problem. We could try to make 
a system similar to the pq-system, except that it represents multiplication, instead of 
addition. Let's call it the tq-system, Y for times'. More specifically, suppose X, Y, and Z 
are, respectively, the numbers of hyphens in the hyphen-strings x, y, and z. (Notice I am 
taking special pains to distinguish between a string and the number of hyphens it 
contains.) Then we wish the string x ty q z to be a theorem if and only if X times Y 

equals Z. For instance, — t — q should be a theorem because 2 times 3 equals 6, but — 

t~q — should not be a theorem. The tq-system can be characterized just about as easily as 
the pq-system namely, by using just one axiom schema and one rule of inference: 

Figure and Ground 


AXIOM SCHEMA: xt-qx is an axiom, whenever x is a hyphen string. 

RULE OF INFERENCE: Suppose that x, y, and z are all hyphen-strings. An suppose that 
x ty qz is an old theorem. Then, xty-qzx is a ne' theorem. 

Below is the derivation of the theorem — t — q 

Notice how the middle hyphen-string grows by one hyphen each time the rule of 
inference is applied; so it is predictable that if you want a theorem with ten hyphens in 
the middle, you apply the rule of inference nine times in a row. 

Multiplication, a slightly trickier concept than addition, has now bee] "captured" 
typographically, like the birds in Escher's Liberation. What about primeness? Here's a 
plan that might seem smart: using the tq-system define a new set of theorems of the form 
Cx, which characterize compost, numbers, as follows: 

RULE: Suppose x, y, and z are hyphen-strings. If x-ty-qz is a theorem then C z is a 

This works by saying that Z (the number of hyphens in z) is composite a long as it is the 
product of two numbers greater than 1 -namely, X + (the number of hyphens in x-), and Y 
+ 1 (the number of hyphens in y I am defending this new rule by giving you some 
"Intelligent mode justifications for it. That is because you are a human being, and want t, 
know why there is such a rule. If you were operating exclusively in the "Mechanical 
mode", you would not need any justification, since M-mod. workers just follow the rules 
mechanically and happily, never questioning; them! 

Because you work in the I-mode, you will tend to blur in your mind the 
distinction between strings and their interpretations. You see, things Cal become quite 
confusing as soon as you perceive "meaning" in the symbol which you are manipulating. 
You have to fight your own self to keep from thinking that the string'—' is the number 3. 
The Requirement of Formality, which in Chapter I probably seemed puzzling (because it 
seemed so obvious), here becomes tricky, and crucial. It is the essential thing which 
keeps you from mixing up the I-mode with the M-mode; or said another way, it keeps 
you from mixing up arithmetical facts with typographical theorems. 

Figure and Ground 73 


__ t _ q-- 
__ t -q ... 


(by rule of inference, using line (1) as the old theorem) 
(by rule of inference, using line (2) as the old theorem) 

Capturing Compositeness 

Illegally Characterizing Primes 

It is very tempting to jump from the C-type theorems directly to P-type theorems, by 
proposing a rule of the following kind: 

PROPOSED RULE: Suppose x is a hyphen-string. If Cx is not a theorem, then Px is a 

The fatal flaw here is that checking whether Cx is not a theorem is not an explicitly 
typographical operation. To know for sure that MU is not a theorem of the MlU-system, 
you have to go outside of the system ... and so it is with this Proposed Rule. It is a rule 
which violates the whole idea of formal systems, in that it asks you to operate informally- 
that is, outside the system. Typographical operation (6) allows you to look into the 
stockpile of previously found theorems, but this Proposed Rule is asking you to look into 
a hypothetical "Table of Nontheorems". But in order to generate such a table, you would 
have to do some reasoning outside the .system-reasoning which shows why various strings 
cannot be generated inside the system. Now it may well be that there is another formal 
system which can generate the "Table of Nontheorems", by purely typographical means. 
In fact, our aim is to find just such a system. But the Proposed Rule is not a typographical 
rule, and must be dropped. 

This is such an important point that we might dwell on it a bit more. In our C- 
system (which includes the tq-system and the rule which defines C-type theorems), we 
have theorems of the form Cx, with V standing, as usual, for a hyphen-string. There are 
also nontheorems of the form Cx. (These are what I mean when I refer to "nontheorems", 
although of course tt-Cqq and other ill-formed messes are also nontheorems.) The 
difference is that theorems have a composite number of hyphens, nontheorems have a 
prime number of hyphens. Now the theorems all have a common "form", that is, originate 
from a common set of typographical rules. Do all nontheorems also have a common 
"form", in the same sense? Below is a list of C-type theorems, shown without their 
derivations. The parenthesized numbers following them simply count the hyphens in 

C-- (4) 
C (6) 

C (8) 

C (9) 

C (10) 

C (12) 

C (14) 

C (15) 

C (16) 

C (18) 

Figure and Ground 74 

I he "holes" in this list are the nontheorems. I o repeat the earlier quest Do the holes also 
have some "form" in common? Would it be reasonable say that merely by virtue of being 
the holes in this list, they share a common form? Yes and no. That they share some 
typographical quality is and able, but whether we want to call it "form" is unclear. The 
reason hesitating is that the holes are only negatively defined-they are the things that are 
left out of a list which is positively defined. 

Figure and Ground 

This recalls the famous artistic distinction between figure and ground. When a figure or 
"positive space" (e.g., a human form, or a letter, or a still life is drawn inside a frame, an 
unavoidable consequence is that its complementary shape-also called the "ground", or 
"background", or "negative space"-has also been drawn. In most drawings, however, this 
fig ground relationship plays little role. The artist is much less interested in ground than 
in the figure. But sometimes, an artist will take interest in ground as well. 

There are beautiful alphabets which play with this figure-ground distinction. A 
message written in such an alphabet is shown below. At fir looks like a collection of 
somewhat random blobs, but if you step back ways and stare at it for a while, all of a 
sudden, you will see seven letters appear in this .. 


For a similar effect, take a look at my drawing Smoke Signal (Fig. 139). Along these 
lines, you might consider this puzzle: can you somehow create a drawing containing 
words in both the figure and the ground? 

Let us now officially distinguish between two kinds of figures: cursively 
drawable ones, and recursive ones (by the way, these are my own terms are not in 
common usage). A cursively drawable figure is one whose ground is merely an 
accidental by-product of the drawing act. A recursive figure is one whose ground can be 
seen as a figure in its own right. Usually this is quite deliberate on the part of the artist. 
The "re" in "recursive" represents the fact that both foreground and background are 
cursively drawable - the figure is "twice-cursive". Each figure-ground boundary in a 
recursive figure is a double-edged sword. M. C. Escher was a master at drawing recursive 
figures-see, for instance, his beautiful recursive drawing of birds (Fig. 16). 

Figure and Ground 


FIGURE 16. Tiling of the plane using birds, by M. C. Escher (from a 1942 notebook). 

Our distinction is not as rigorous as one in mathematics, for who can definitively 
say that a particular ground is not a figure? Once pointed out, almost any ground has 
interest of its own. In that sense, every figure is recursive. But that is not what I intended 
by the term. There is a natural and intuitive notion of recognizable forms. Are both the 
foreground and background recognizable forms? If so, then the drawing is recursive. If 
you look at the grounds of most line drawings, you will find them rather unrecognizable. 
This demonstrates that 

There exist recognizable forms whose negative space is not any recognizable form. 

In more "technical" terminology, this becomes: 

There exist cursively drawable figures which are not recursive. 

Scott Kim's solution to the above puzzle, which I call his "FIGURE-FIGURE 
Figure", is shown in Figure 17. If you read both black and white, 

Figure and Ground 


FIGURE 17. FIGURE-FIGURE Figure, by Scott E. Kim (1975). 

Figure and Ground 

you will see "FIGURE" everywhere, but "GROUND" nowhere! It is a paragon of 
recursive figures. In this clever drawing, there are two nonequivalent ways of 
characterizing the black regions: 

(1) as the negative space to the white regions; 

(2) as altered copies of the white regions (produced by coloring and shifting each 

white region). 

(In the special case of the FIGURE-FIGURE Figure, the two characterizations are 
equivalent-but in most black-and-white pictures, they would not be.) Now in Chapter 
VIII, when we create our Typographical Number Theory (TNT), it will be our hope that 
the set of all false statements of number theory can be characterized in two analogous 

(1) as the negative space to the set of all TNT-theorems; 

(2) as altered copies of the set of all TNT-theorems (produced by negating each 


But this hope will be dashed, because: 

(1) inside the set of all nontheorems are found some truths 

(2) outside the set of all negated theorems are found some falsehoods 

You will see why and how this happens, in Chapter XIV. Meanwhile, ponder over a 
pictorial representation of the situation (Fig. 18). 

Figure and Ground in Music 

One may also look for figures and grounds in music. One analogue is the distinction 
between melody and accompaniment-for the melody is always in the forefront of our 
attention, and the accompaniment is subsidiary, in some sense. Therefore it is surprising 
when we find, in the lower lines of a piece of music, recognizable melodies. This does 
not happen too often in post-baroque music. Usually the harmonies are not thought of as 
foreground. But in baroque music-in Bach above all-the distinct lines, whether high or 
low or in between, all act as "figures". In this sense, pieces by Bach can be called 

Another figure-ground distinction exists in music: that between on-beat and off- 
beat. If you count notes in a measure "one-and, two-and, three-and, four-and", most 
melody-notes will come on numbers, not on "and"'s. But sometimes, a melody will be 
deliberately pushed onto the "and" 's, for the sheer effect of it. This occurs in several 
etudes for the piano by Chopin, for instance. It also occurs in Bach-particularly in his 
Sonatas and Partitas for unaccompanied violin, and his Suites for unaccompanied cello. 
There, Bach manages to get two or more musical lines going simultaneously. Sometimes 
he does this by having the solo instrument play "double stops"-two notes at once. Other 
times, however, he 

Figure and Ground 


Well-formed formula* 

FIGURE 18. Considerable visual symbolism is featured in this diagram of the relation 
between various classes of TNT strings. The biggest box represents the set of all TNT 
strings The next-biggest box represents the set of all well-formed TNT strings. Within it is 
found- set of all sentences of TNT. Now things begin to get interesting. The set of 
theorems pictured as a tree growing out of a trunk (representing the set of axioms). The 
tree-symbol chosen because of the recursive growth pattern which it exhibits: new 
branches (theorems constantly sprouting from old ones. The fingerlike branches probe 
into the corners of constraining region (the set of truths), yet can never fully occupy it. 
The boundary beta the set of truths and the set of falsities is meant to suggest a randomly 
meandering coastline which, no matter how closely you examine it, always has finer 
levels of structure, an consequently impossible to describe exactly in any finite way. (See 
B. Mandelbrot's book Fractals.) The reflected tree represents the set of negations of 
theorems: all of them false yet unable collectively to span the space of false statements. 
[Drawing by the author.] 

puts one voice on the on-beats, and the other voice on the off-beats, so ear separates them 
and hears two distinct melodies weaving in and out, - harmonizing with each other. 
Needless to say, Bach didn't stop at this level of complexity... 

Recursively Enumerable Sets vs. Recursive Sets 

Now let us carry back the notions of figure and ground to the domain formal 
systems. In our example, the role of positive space is played by C-type theorems, and the 
role of negative space is played by strings with a 

Figure and Ground 


prime number of hyphens. So far, the only way we have found to represent prime 
numbers typographically is as a negative space. Is there, however, some way-I don't care 
how complicated-of representing the primes as a positive space-that is, as a set of 
theorems of some formal system? 

Different people's intuitions give different answers here. I remember quite vividly 
how puzzled and intrigued I was upon realizing the difference between a positive 
characterization and a negative characterization. I was quite convinced that not only the 
primes, but any set of numbers which could be represented negatively, could also be 
represented positively. The intuition underlying my belief is represented by the question: 
"How could a figure and its ground not carry exactly the same information!" They 
seemed to me to embody the same information, just coded in two complementary ways. 
What seems right to you? 

It turns out I was right about the primes, but wrong in general. This astonished 
me, and continues to astonish me even today. It is a fact that: 

There exist formal systems whose negative space (set of nontheorems) is not 
the positive space (set of theorems) of any formal system. 

This result, it turns out, is of depth equal to Godel's Theorem-so it is not 
surprising that my intuition was upset. I, just like the mathematicians of the early 
twentieth century, expected the world of formal systems and natural numbers to be more 
predictable than it is. In more technical terminology, this becomes: 

There exist recursively enumerable sets which are not recursive. 

The phrase recursively enumerable (often abbreviated "r.e.") is the mathematical 
counterpart to our artistic notion of "cursively drawable"-and recursive is the counterpart 
of "recursive". For a set of strings to be "r.e." means that it can be generated according to 
typographical rules-for example, the set of C-type theorems, the set of theorems of the 
MlU-system-indeed, the set of theorems of any formal system. This could be compared 
with the conception of a "figure" as "a set of lines which can be generated according to 
artistic rules" (whatever that might mean!). And a "recursive set" is like a figure whose 
ground is also a figure-not only is it r.e., but its complement is also r.e. 
It follows from the above result that: 

There exist formal systems for which there is no typographical decision 

How does this follow? Very simply. A typographical decision procedure is a 
method which tells theorems from nontheorems. The existence of such a test allows us to 
generate all nontheorems systematically, simply by going down a list of all strings and 
performing the test on them one at a time, discarding ill-formed strings and theorems 
along the way. This amounts to 

Figure and Ground 


a typographical method for generating the set of nontheorems. But according to the 
earlier statement (which we here accept on faith), for some systems this is not possible. 
So we must conclude that typographical decision procedures do not exist for all formal 

Suppose we found a set F of natural numbers (\P for 'Figure') whi4 we could 
generate in some formal way-like the composite numbers. Suppose its complement is the 
set G (for 'Ground')-like the primes. Together F and G make up all the natural numbers, 
and we know a rule for making all the numbers in set F, but we know no such rule for 
making all tl numbers in set G. It is important to understand that if the members of were 
always generated in order of increasing size, then we could always characterize G. The 
problem is that many r.e. sets are generated I methods which throw in elements in an 
arbitrary order, so you never know if a number which has been skipped over for a long 
time will get included you just wait a little longer. 

We answered no to the artistic question, "Are all figures recursive We have now 
seen that we must likewise answer no to the analogous question in mathematics: "Are all 
sets recursive?" With this perspective, 1 us now come back to the elusive word "form". 
Let us take our figure-set and our ground-set G again. We can agree that all the numbers 
in set have some common "form"-but can the same be said about numbers in s G? It is a 
strange question. When we are dealing with an infinite set to sta with-the natural 
numbers-the holes created by removing some subs may be very hard to define in any 
explicit way. And so it may be that th< are not connected by any common attribute or 
"form". In the last analysis it is a matter of taste whether you want to use the word 
"form"-but just thinking about it is provocative. Perhaps it is best not to define "form", bi 
to leave it with some intuitive fluidity. 

Here is a puzzle to think about in connection with the above matter Can you 
characterize the following set of integers (or its negative space) 

1 3 7 12 18 26 35 45 56 69... 

How is this sequence like the FIGURE -FIGURE Figure? 

Primes as Figure Rather than Ground 

Finally, what about a formal system for generating primes? How is it don< The trick is to 
skip right over multiplication, and to go directly to nondivisibility as the thing to 
represent positively. Here are an axiom schema and rule for producing theorems which 
represent the notion that one number does not divide (D N D) another number exactly: 

AXIOM SCHEMA: xy D N Dx where x and y are hyphen-strings. 

For example — D N D~, where x has been replaced by'~'and y by ' — ". 

Figure and Ground 


RULE: If x D N Dy is a theorem, then so is x D N Dx y. 

If you use the rule twice, you can generate this theorem: 

D N D 

which is interpreted as "5 does not divide 12". But — D N D is not a theorem. 

What goes wrong if you try to produce it? 

Now in order to determine that a given number is prime, we have to build up 
some knowledge about its nondivisibility properties. In particular, we want to know that 
it is not divisible by 2 or 3 or 4, etc., all the way up to 1 less than the number itself. But 
we can't be so vague in formal systems as to say "et cetera". We must spell things out. 
We would like to have a way of saying, in the language of the system, "the number Z is 
divisor free up to X", meaning that no number between 2 and X divides Z. This can be 
done, but there is a trick to it. Think about it if you want. 

Here is the solution: 

RULE: If -D N D z is a theorem, so is z D F-. 

RULE: If z D Fx is a theorem and also x-D N Dz is a theorem, z D Fx- is a theorem. 

These two rules capture the notion of divisor freeness. All we need to do is to say that 
primes are numbers which are divisor-free up to 1 less than themselves: 

RULE: If z-DFz is a theorem, then Pz- is a theorem. 

Oh-let's not forget that 2 is prime! 

Axiom: P~. 

And there you have it. The principle of representing primality formally is that there is a 
test for divisibility which can be done without any backtracking. You march steadily 
upward, testing first for divisibility by 2, then by 3, and so on. It is this "monotonicity" or 
unidirectionality-this absence of cross-play between lengthening and shortening, 
increasing and decreasing-that allows primality to be captured. And it is this potential 
complexity of formal systems to involve arbitrary amounts of backwards-forwards 
interference that is responsible for such limitative results as Godel's Theorem, Turing's 
Halting Problem, and the fact that not all recursively enumerable sets are recursive. 

Figure and Ground 



Achilles has come to visit his friend and jogging companion, the 
Tortoise, at his home 

Achilles: Heavens, you certainly have an admirable boomerang collection 
Tortoise: Oh, pshaw. No better than that of any other Tortoise. And now would you like 
to step into the parlor? 

Achilles: Fine. {Walks to the corner of the room) I see you also have a large collection of 

records. What sort of music do you enjoy? 
Tortoise: Sebastian Bach isn't so bad, in my opinion. But these days, I must say, I am 

developing more and more of an interest in a rather specialized sort of music. 
Achilles: Tell me, what kind of music is that? 

Tortoise: A type of music which you are most unlikely to have heard of. call it "music to 

break phonographs by". 
Achilles: Did you say "to break phonographs by"? That is a curious concept. I can just 

see you, sledgehammer in hand, whacking on phonograph after another to pieces, 

to the strains of Beethoven's heroic masterpiece Wellington's Victory. 
Tortoise: That's not quite what this music is about. However, you might find its true 

nature just as intriguing. Perhaps I should give you a brief description of it? 
Achilles: Exactly what I was thinking. 

Tortoise: Relatively few people are acquainted with it. It all began whet my friend the 
Crab-have you met him, by the way?-paid m» a visit. 

Achilles: ' twould be a pleasure to make his acquaintance, I'm sure Though I've heard so 
much about him, I've never met him 

Tortoise: Sooner or later I'll get the two of you together. You'd hit it of splendidly. 
Perhaps we could meet at random in the park on day ... 

Achilles: Capital suggestion! I'll be looking forward to it. But you were going to tell me 
about your weird "music to smash phone graphs by", weren't you? 

Tortoise: Oh, yes. Well, you see, the Crab came over to visit one day. You must 
understand that he's always had a weakness for fang gadgets, and at that time he 
was quite an aficionado for, of al things, record players. He had just bought his 
first record player, and being somewhat gullible, believed every word the 
salesman had told him about it-in particular, that it was capable of reproducing 
any and all sounds. In short, he was convinced that it was a Perfect phonograph. 



Achilles: Naturally, I suppose you disagreed. 

Tortoise: True, but he would hear nothing of my arguments. He staunchly maintained that 
any sound whatever was reproducible on his machine. Since I couldn't convince 
him of the contrary, I left it at that. But not long after that, I returned the visit, 
taking with me a record of a song which I had myself composed. The song was 
called "I Cannot Be Played on Record Player 1". 

Achilles: Rather unusual. Was it a present for the Crab? 

Tortoise: Absolutely. I suggested that we listen to it on his new phonograph, and he was 
very glad to oblige me. So he put it on. But unfortunately, after only a few notes, 
the record player began vibrating rather severely, and then with a loud "pop", 
broke into a large number of fairly small pieces, scattered all about the room. The 
record was utterly destroyed also, needless to say. 

Achilles: Calamitous blow for the poor fellow, I'd say. What was the matter with his 
record player? 

Tortoise: Really, there was nothing the matter, nothing at all. It simply couldn't reproduce 

the sounds on the record which I had brought him, because they were sounds that 

would make it vibrate and break. 
Achilles: Odd, isn't it? I mean, I thought it was a Perfect phonograph. That's what the 

salesman had told him, after all. 
Tortoise: Surely, Achilles, you don't believe everything that salesmen tell you! Are you 

as naive as the Crab was? 
Achilles: The Crab was naiver by far! I know that salesmen are notorious prevaricators. I 

wasn't born yesterday! 

Tortoise: In that case, maybe you can imagine that this particular salesman had somewhat 
exaggerated the quality of the Crab's piece of equipment ... perhaps it was indeed 
less than Perfect, and could not reproduce every possible sound. 

Achilles: Perhaps that is an explanation. But there's no explanation for the amazing 
coincidence that your record had those very sounds on it ... 

Tortoise: Unless they got put there deliberately. You see, before returning the Crab's 
visit, I went to the store where the Crab had bought his machine, and inquired as 
to the make. Having ascertained that, I sent off to the manufacturers for a 
description of its design. After receiving that by return mail, I analyzed the entire 
construction of the phonograph and discovered a certain set of sounds which, if 
they were produced anywhere in the vicinity, would set the device to shaking and 
eventually to falling apart. 

Achilles: Nasty fellow! You needn't spell out for me the last details: that you recorded 
those sounds yourself, and offered the dastardly item as a gift ... 



Tortoise: Clever devil! You jumped ahead of the story! But that wasn't t end of the 
adventure, by any means, for the Crab did r believe that his record player was at 
fault. He was quite stubborn. So he went out and bought a new record player, this 
o even more expensive, and this time the salesman promised give him double his 
money back in case the Crab found a soul which it could not reproduce exactly. 
So the Crab told r excitedly about his new model, and I promised to come over 
and see it. 

Achilles: Tell me if I'm wrong-I bet that before you did so, you on again wrote the 
manufacturer, and composed and recorded new song called "I Cannot Be Played 
on Record Player based on the construction of the new model. 

Tortoise: Utterly brilliant deduction, Achilles. You've quite got the spirit. 

Achilles: So what happened this time? 

Tortoise: As you might expect, precisely the same thing. The phonograph fell into 
innumerable pieces, and the record was shattered. Achilles: Consequently, the 
Crab finally became convinced that there could be no such thing as a Perfect 
record player. 

Tortoise: Rather surprisingly, that's not quite what happened. He was sure that the next 
model up would fill the bill, and having twice the money, h e— 

Achilles: Oho-I have an idea! He could have easily outwitted you, I obtaining a LOW- 
fidelity phonograph-one that was not capable of reproducing the sounds which 
would destroy it. In that way, he would avoid your trick. 

Tortoise: Surely, but that would defeat the-original purpose-namely, to have a 
phonograph which could reproduce any sound whatsoever, even its own self- 
breaking sound, which is of coup impossible. 

Achilles: That's true. I see the dilemma now. If any record player-si 

Record Player X-is sufficiently high-fidelity, then when attempts to play the song "I 
Cannot Be Played on Record Player X", it will create just those vibrations which 
will cause to break. .. So it fails to be Perfect. And yet, the only way to g, around 
that trickery, namely for Record Player X to be c lower fidelity, even more 
directly ensures that it is not Perfect It seems that every record player is 
vulnerable to one or the other of these frailties, and hence all record players are 

Tortoise: I don't see why you call them "defective". It is simply an inherent fact about 
record players that they can't do all that you might wish them to be able to do. But 
if there is a defect anywhere, is not in THEM, but in your expectations of what 
they should b able to do! And the Crab was just full of such unrealistic 



Achilles: Compassion for the Crab overwhelms me. High fidelity or low fidelity, he loses 
either way. 

Tortoise: And so, our little game went on like *_his for a few more rounds, and 
eventually our friend tried to become very smart. He got wind of the principle 
upon which I was basing my own records, and decided to try to outfox me. He 
wrote to the phonograph makers, and described a device of his own invention, 
which they built to specification. He called it "Record Player Omega". It was 
considerably more sophisticated than an ordinary record player. 

Achilles: Let me guess how: Did it have no of cotton? Or 

Tortoise: Let me tell you, instead. That will save some time. In the first place, Record 
Player Omega incorporated a television camera whose purpose it was to scan any 
record before playing it. This camera was hooked up to a small built-in computer, 
which would determine exactly the nature of the sounds, by looking at the groove- 

Achilles: Yes, so far so good. But what could Record Player Omega do with this 

Tortoise: By elaborate calculations, its little computer figured out what effects the sounds 
would have upon its phonograph. If it deduced that the sounds were such that they 
would cause the machine in its present configuration to break, then it did 
something very clever. Old Omega contained a device which could disassemble 
large parts of its phonograph subunit, and rebuild them in new ways, so that it 
could, in effect, change its own structure. If the sounds were "dangerous", a new 
configuration was chosen, one to which the sounds would pose no threat, and this 
new configuration would then be built by the rebuilding subunit, under direction 
of the little computer. Only after this rebuilding operation would Record Player 
Omega attempt to play the record. 

Achilles: Aha! That must have spelled the end of your tricks. I bet you were a little 

Tortoise: Curious that you should think so ... I don't suppose that you know Godel's 

Incompleteness Theorem backwards and forwards, do you? 
Achilles: Know WHOSE Theorem backwards and forwards? I've 

heard of anything that sounds like that. I'm sure it's fascinating, but I'd rather hear more 
about "music to break records by". It's an amusing little story. Actually, I guess I 
can fill in the end. Obviously, there was no point in going on, and so you 
sheepishly admitted defeat, and that was that. Isn't that exactly it? 

Tortoise: What! It's almost midnight! I'm afraid it's my bedtime. I'd love to talk some 
more, but really I am growing quite sleepy. 



Achilles: As am 1 . Well, 1 u be on my way. (As he reaches the door, he suddenly stops, 
and turns around.) Oh, how silly of me! I almost forgo brought you a little 
present. Here. (Hands the Tortoise a small neatly wrapped package.) 

Tortoise: Really, you shouldn't have! Why, thank you very much indeed think I'll open it 
now. (Eagerly tears open the package, and ins discovers a glass goblet) Oh, what 
an exquisite goblet! Did y know that I am quite an aficionado for, of all things, gl 

Achilles: Didn't have the foggiest. What an agreeable coincidence! 

Tortoise: Say, if you can keep a secret, I'll let you in on something: I trying to find a 
Perfect goblet: one having no defects of a sort in its shape. Wouldn't it be 
something if this goblet-h call it "G"-were the one? Tell me, where did you come 
across Goblet G? 

Achilles: Sorry, but that's MY little secret. But you might like to know w its maker is. 
Tortoise: Pray tell, who is it? 

Achilles: Ever hear of the famous glassblower Johann Sebastian Bach? Well, he wasn't 
exactly famous for glassblowing-but he dabbled at the art as a hobby, though 
hardly a soul knows it-a: this goblet is the last piece he blew. 

Tortoise: Literally his last one? My gracious. If it truly was made by Bach its value is 
inestimable. But how are you sure of its maker 

Achilles: Look at the inscription on the inside-do you see where tletters 'B', 'A, C, "H 
have been etched? 

Tortoise: Sure enough! What an extraordinary thing. (Gently sets Goblet G down on a 
shelf.) By the way, did you know that each of the four letters in\Bach's name is 
the name of a musical note? 

Achilles:' tisn't possible, is it? After all, musical notes only go from 'A' through 'G. 

Tortoise: Just so; in most countries, that's the case. But in Germany, Bach's own 
homeland, the convention has always been similar, except that what we call 'B', 
they call 'H', and what we call 'B-flaf, they call 'B'. For instance, we talk about 
Bach's "Mass in B Minor whereas they talk about his "H-moll Messe". Is that 

Achilles: ... hmm ... I guess so. It's a little confusing: H is B, and B B-flat. I suppose 
his name actually constitutes a melody, then 

Tortoise: Strange but true. In fact, he worked that melody subtly into or of his most 
elaborate musical pieces-namely, the final Contrapunctus in his Art of the Fugue. 
It was the last fugue Bach ever wrote. When I heard it for the first time, I had no 
idea how would end. Suddenly, without warning, it broke off. And the ... dead 
silence. I realized immediately that was where Bach died. It is an indescribably 
sad moment, and the effect it had o me was-shattering. In any case, B-A-C-H is 
the last theme c that fugue. It is hidden inside the piece. Bach didn't point it out 



FIGURE 19. The last page of Bach's Art of the Fugue. In the original manuscript, in the 
handwriting of Bach's son Carl Philipp Emanuel, is written: "N.B. In the course of this 
fugue, at the point where the name B.A.C.H. was brought in as countersubject, the 
composer died. " (B-A-C-H in box.) I have let this final page of Bach 's last fugue serve as 
an epitaph. 

[Music Printed by Donald Byrd's program "SMUT", developed at Indiana University] 



Explicitly, but if you know about it, you can find it without much trouble. Ah, me-there 
are so many clever ways of hiding things in music .. . 

Achilles: . . or in poems. Poets used to do very similar things, you know (though it's 
rather out of style these days). For instance, Lewis Carroll often hid words and 
names in the first letters (or characters) of the successive lines in poems he wrote. 
Poems which conceal messages that way are called "acrostics". 

Tortoise: Bach, too, occasionally wrote acrostics, which isn't surprising. After all, 
counterpoint and acrostics, with their levels of hidden meaning, have quite a bit in 
common. Most acrostics, however, have only one hidden level-but there is no 
reason that one couldn't make a double-decker- an acrostic on top of an acrostic. 
Or one could make a "contracrostic"-where the initial letters, taken in reverse 
order, form a message. Heavens! There's no end to the possibilities inherent in the 
form. Moreover, it's not limited to poets; anyone could write acrostics-even a 

Achilles: A dial-a-logician? That's a new one on me. 

Tortoise: Correction: I said "dialogician", by which I meant a writer of dialogues. Hmm 
... something just occurred to me. In the unlikely event that a dialogician should 
write a contrapuntal acrostic in homage to J. S. Bach, do you suppose it would be 
more proper for him to acrostically embed his OWN name-or that of Bach? Oh, 
well, why worry about such frivolous matters? Anybody who wanted to write 
such a piece could make up his own mind. Now getting back to Bach's melodic 
name, did you know that the melody B-A-C-H, if played upside down and 
backwards, is exactly the same as the original? 

Achilles: How can anything be played upside down? Backwards, I can see-you get H-C- 
A-B-but upside down? You must be pulling my leg. 

Tortoise: ' pon my word, you're quite a skeptic, aren't you? Well, I guess I'll have to give 
you a demonstration. Let me just go and fetch my fiddle- (Walks into the next 
room, and returns in a jiffy with an ancient-looking violin.) -and play it for you 
forwards and backwards and every which way. Let's see, now ... (Places his copy 
of the Art of the Fugue on his music stand and opens it to the last page.) ... here's 
the last Contrapunctus, and here's the last theme ... 

The Tortoise begins to play: B-A-C- - but as he bows the final H, suddenly, 
without warning, a shattering sound rudely interrupts his performance. Both 
he and Achilles spin around, just in time to catch a glimpse of myriad 
fragments of glass tinkling to the floor from the shelf where Goblet G had 
stood, only moments before. And then ... dead silence. 



Chapter IV 

Consistency, Completeness, 
and Geometry 

Implicit and Explicit Meaning 

IN CHAPTER II, we saw how meaning-at least in the relatively simple context of formal 
systems-arises when there is an isomorphism between rule-governed symbols, and things 
in the real world. The more complex the isomorphism, in general, the more "equipment"- 
both hardware and software-is required to extract the meaning from the symbols. If an 
isomorphism is very simple (or very familiar), we are tempted to say that the meaning 
which it allows us to see is explicit. We see the meaning without seeing the isomorphism. 
The most blatant example is human language, where people often attribute meaning to 
words in themselves, without being in the slightest aware of the very complex 
"isomorphism" that imbues them with meanings. This is an easy enough error to make. It 
attributes all the meaning to the object (the word), rather than to the link between that 
object and the real world. You might compare it to the naive belief that noise is a 
necessary side effect of any collision of two objects. This is a false belief; if two objects 
collide in a vacuum, there will be no noise at all. Here again, the error stems from 
attributing the noise exclusively to the collision, and not recognizing the role of the 
medium, which carries it from the objects to the ear. 

Above, I used the word "isomorphism" in quotes to indicate that it must be taken 
with a grain of salt. The symbolic processes which underlie the understanding of human 
language are so much more complex than the symbolic processes in typical formal 
systems, that, if we want to continue thinking of meaning as mediated by isomorphisms, 
we shall have to adopt a far more flexible conception of what isomorphisms can be than 
we have up till now. In my opinion, in fact, the key element in answering the question 
"What is consciousness?" will be the unraveling of the nature of the "isomorphism" 
which underlies meaning. 

Explicit Meaning of the Contracrostipunctus 

All this is by way of preparation for a discussion of the Contracrostipunctus -a study in 
levels of meaning. The Dialogue has both explicit and implicit meanings. Its most 
explicit meaning is simply the story 

Consistency, Completeness, and Geometry 


Which was related. This "explicit meaning is, strictly speaking extremely implicit, in the 
sense that the brain processes required to understand the events in the story, given only 
the black marks on paper, are incredibly complex. Nevertheless, we shall consider the 
events in the story to be the explicit meaning of the Dialogue, and assume that every 
reader of English uses more or less the same "isomorphism" in sucking that meaning 
from the marks on the paper. 

Even so, I'd like to be a little more explicit about the explicit meaning of the story. 
First I'll talk about the record players and the records. The main point is that there are two 
levels of meaning for the grooves in the records. Level One is that of music. Now what is 
"music"-a sequence of vibrations in the air, or a succession of emotional responses in a 
brain? It is both. But before there can be emotional responses, there have to be vibrations. 
Now the vibrations get "pulled" out of the grooves by a record player, a relatively 
straightforward device; in fact you can do it with a pin, just pulling it down the grooves. 
After this stage, the ear converts the vibrations into firings of auditory neurons in the 
brain. Then ensue a number of stages in the brain, which gradually transform the linear 
sequence of vibrations into a complex pattern of interacting emotional responses-far too 
complex for us to go into here, much though I would like to. Let us therefore content 
ourselves with thinking of the sounds in the air as the "Level One" meaning of the 

What is the Level Two meaning of the grooves? It is the sequence of vibrations induced 
in the record player. This meaning can only arise after the Level One meaning has been 
pulled out of the grooves, since the vibrations in the air cause the vibrations in the 
phonograph. Therefore, the Level Two meaning depends upon a chain of two 

(1) Isomorphism between arbitrary groove patterns and air 

(2) Isomorphism between graph vibrations, arbitrary air 
vibrations and phonograph vibrations 

This chain of two isomorphisms is depicted in Figure 20. Notice that isomorphism I is the 
one which gives rise to the Level One meaning. The Level Two meaning is more implicit 
than the Level One meaning, because it is mediated by the chain of two isomorphisms. It 
is the Level Two meaning which "backfires", causing the record player to break apart. 
What is of interest is that the production of the Level One meaning forces the production 
of the Level Two meaning simultaneously-there is no way to have Level One without 
Level Two. So it was the implicit meaning of the record which turned back on it, and 
destroyed it. 

Similar comments apply to the goblet. One difference is that the mapping from 
letters of the alphabet to musical notes is one more level of isomorphism, which we could 
call "transcription". That is followed by "translation"-conversion of musical notes into 
musical sounds. Thereafter, the vibrations act back on the goblet just as they did on the 
escalating series of phonographs. 

Consistency, Completeness, and Geometry 


FIGURE 20. Visual rendition of the principle underlying Godel's Theorem: two back-to- 
back mappings which have an unexpected boomeranging effect. The first is from groove 
patterns to sounds, carried out by a phonograph. The second-familiar, but usually 
ignored — is from sounds to vibrations of the phonograph. Note that the second mapping 
exists independently of the first one, for any sound in the vicinity, not just ones produced 
by the phonograph itself, will cause such vibrations. The paraphrase of Godel's Theorem 
says that for any record player, there are records which it cannot play because they will 
cause its indirect self-destruction. [Drawing by the author. 

Implicit Meanings of the Contracrostipunctus 

What about implicit meanings of the Dialogue? (Yes, it has more than one of these.) The 
simplest of these has already been pointed out in the paragraphs above-namely, that the 
events in the two halves of the dialogue are roughly isomorphic to each other: the 
phonograph becomes a violin, the Tortoise becomes Achilles, the Crab becomes the 
Tortoise, the grooves become the etched autograph, etc. Once you notice this simple 
isomorphism, you can go a little further. Observe that in the first half of the story, the 
Tortoise is the perpetrator of all the mischief, while in the second half, he is the victim. 
What do you know, but his own method has turned around and backfired on him! 
Reminiscent of the backfiring of the records' muusic-or the goblet's inscription-or perhaps 
of the Tortoise's boomerang collection? Yes, indeed. The story is about backfiring on two 
levels, as follows ... 

Level One: Goblets and records which backfire; 

Level Two: The Tortoise's devilish method of exploiting implicit meaning to 
cause backfires-which backfires. 

Therefore we can even make an isomorphism between the two levels of the story, 
in which we equate the way in which the records and goblet boomerang back to destroy 
themselves, with the way in which the Tortoise's own fiendish method boomerangs back 
to get him in the end. Seen this 

Consistency, Completeness, and Geometry 


way, the story itself is an example of the backfirings which it discusses. So we can think 
of the Contracrostipunctus as referring to itself indirectly that its own structure is 
isomorphic to the events it portrays. (Exactly goblet and records refer implicitly to 
themselves via the back-to-back morphisms of playing and vibration-causing.) One may 
read the Dialogue without perceiving this fact, of course-but it is there all the time. 

Mapping Between the Contracrostipunctus 
and Godel's Theorem 

Now you may feel a little dizzy-but the best is yet to come. (Actually, levels of 
implicit meaning will not even be discussed here -they will 1 for you to ferret out.) The 
deepest reason for writing this Dialogue illustrate Godel's Theorem, which, as I said in 
the Introduction, heavily on two different levels of meaning of statements of number tl 
Each of the two halves of the Contracrostipunctus is an "isomorphic co Godel's Theorem. 
Because this mapping is the central idea of the Dialogue and is rather elaborate, I have 
carefully charted it out below. 

Phonograph <= =>axiomatic system for number theory 

low-fidelity phonograph <= =>"weak" axiomatic system 

high-fidelity phonograph <= =>"strong" axiomatic system 

"Perfect" phonograph" <= => complete system for number theory' 

Blueprint" of phonograph <= => axioms and rules of formal system 

record <= => string of the formal system 

playable record<= => theorem of the axiomatic system 

unplayable record <= =>nontheorem of the axiomatic system 

sound <= =>true statement of number theory 

reproducible sound <= => 'interpreted theorem of the system 

unreproducible sound <= => true statement which isn't a theorem: 

song title <= =>implicit meaning of Godel's string: 

"I Cannot Be Played "I Cannot Be Derived 

on Record Player X" in Formal System X" 

This is not the full extent of the isomorphism between Godel's theorem and the 
Contracrostipunctus, but it is the core of it. You need not if you don't fully grasp Godel's 
Theorem by now-there are still Chapters to go before we reach it! Nevertheless, having 
read this Dialogue you have already tasted some of the flavor of Godel's Theorem 
without necessarily being aware of it. I now leave you to look for any other types of 
implicit meaning in the Contracrostipunctus. "Quaerendo invenietis!" 

Consistency, Completeness, and Geometry 


The Art of the Fugue 

A few words on the Art of the Fugue ... Composed in the last year of Bach's life, it is a 
collection of eighteen fugues all based on one theme. Apparently, writing the Musical 
Offering was an inspiration to Bach. He decided to compose another set of fugues on a 
much simpler theme, to demonstrate the full range of possibilities inherent in the form. In 
the Art of the Fugue, Bach uses a very simple theme in the most complex possible ways. 
The whole work is in a single key. Most of the fugues have four voices, and they 
gradually increase in complexity and depth of expression. Toward the end, they soar to 
such heights of intricacy that one suspects he can no longer maintain them. Yet he does . . 
. until the last Contrapunctus . 

The circumstances which caused the break-off of the Art of the Fugue (which is to 
say, of Bach's life) are these: his eyesight having troubled him for years, Bach wished to 
have an operation. It was done; however, it came out quite poorly, and as a consequence, 
he lost his sight for the better part of the last year of his life. This did not keep him from 
vigorous work on his monumental project, however. His aim was to construct a complete 
exposition of fugal writing, and usage of multiple themes was one important facet of it. In 
what he planned as the next-to-last fugue, he inserted his own name coded into notes as 
the third theme. However, upon this very act, his health became so precarious that he was 
forced to abandon work on his cherished project. In his illness, he managed to dictate to 
his son-in-law a final chorale prelude, of which Bach's biographer Forkel wrote, "The 
expression of pious resignation and devotion in it has always affected me whenever I 
have played it; so that I can hardly say which I would rather miss-this Chorale, or the end 
of the last fugue." 

One day, without warning, Bach regained his vision. But a few hours later, he 
suffered a stroke; and ten days later, he died, leaving it for others to speculate on the 
incompleteness of the Art of the Fugue. Could it have been caused by Bach's attainment 
of self-reference? 

Problems Caused by Godel's Result 

The Tortoise says that no sufficiently powerful record player can be perfect, in the 
sense of being able to reproduce every possible sound from a record. Godel says that no 
sufficiently powerful formal system can be perfect, in the sense of reproducing every 
single true statement as a theorem. But as the Tortoise pointed out with respect to 
phonographs, this fact only seems like a defect if you have unrealistic expectations of 
what formal systems should be able to do. Nevertheless, mathematicians began this 
century with just such unrealistic expectations, thinking that axiomatic reasoning was the 
cure to all ills. They found out otherwise in 1931. The fact that truth transcends 
theoremhood, in any given formal system, is called "incompleteness" of that system. 

A most puzzling fact about Godel's method of proof is that he uses 

Consistency, Completeness, and Geometry 


reasoning methods which seemingly cannot be "encapsulated" -they re being incorporated 
into any formal system. Thus, at first sight, it seems that Godel has unearthed a hitherto 
unknown, but deeply significant, difference between human reasoning and mechanical 
reasoning. This mysterious discrepancy in the power of living and nonliving systems is 
mirrored in the discrepancy between the notion of truth, and that of theoremhood or at 
least that is a "romantic" way to view the situation. 

The Modified pq-System and Inconsistency 

In order to see the situation more realistically, it is necessary to see in, depth why 
and how meaning is mediated, in formal systems, by isomorphisms. And I believe that 
this leads to a more romantic way to view i situation. So we now will proceed to 
investigate some further aspects of 1 relation between meaning and form. Our first step is 
to make a new formal system by modifying our old friend, the pq-system, very slightly. 
We a one more axiom schema (retaining the original one, as well as the sin rule of 

Axiom SCHEMA II: If x is a hyphen-string, then xp-qx is an axiom. 

Clearly, then, ~p-q~ is a theorem in the new system, and so ~p~q — . And yet, their 
interpretations are, respectively, "2 plus; equals 2", and "2 plus 2 equals 3". It can be seen 
that our new system contain a lot of false statements (if you consider strings to be 
statement Thus, our new system is inconsistent with the external world. 

As if this weren't bad enough, we also have internal problems with < new system, 
since it contains statements which disagree with one another such as -p-q~ (an old 
axiom) and -p-q- (a new axiom). So our system is inconsistent in a second sense: 

Would, therefore, the only reasonable thing to do at this point be drop the new 
system entirely? Hardly. I have deliberately presented the "inconsistencies" in a wool- 
pulling manner: that is, I have tried to press fuzzy-headed arguments as strongly as 
possible, with the purpose of n leading. In fact, you may well have detected the fallacies 
in what I hi said. The crucial fallacy came when I unquestioningly adopted the very same 
interpreting words for the new system as I had for the old of Remember that there was 
only one reason for adopting those words in I last Chapter, and that reason was that the 
symbols acted isomorphically to concepts which they were matched with, by the 
interpretation. But when y modify the rules governing the system, you are bound to 
damage t isomorphism. It just cannot be helped. Thus all the problems which we 
lamented over in preceding paragraphs were bogus problems; they can made to vanish in 
no time, by suitably reinterpreting some of the symbols of system. Notice that I said 
"some"; not necessarily all symbols will have to mapped onto new notions. Some may 
very well retain their "meaning while others change. 

Consistency, Completeness, and Geometry 


Suppose, for instance, that we reinterpret just the symbol q, leaving all the others 
constant; in particular, interpret q by the phrase "is greater than or equal to". Now, our 
"contradictory" theorems -p-q-and -p-q~come out harmlessly as: "1 plus 1 is greater than 
or equal to 1", and "1 plus 1 is greater than or equal to 2". We have simultaneously gotten 
rid of (1) the inconsistency with the external world, and (2) the internal inconsistency. 
And our new interpretation is a meaningful interpretation; of course the original one is 
meaningless. That is, it is meaningless for the new system; for the original pq-system, it is 
fine. But it now seems as pointless and arbitrary to apply it to the new pq-system as it 
was to apply the "horse-apple-happy" interpretation to the old pq-system. 

The History of Euclidean Geometry 

Although I have tried to catch you off guard and surprise you a little, this lesson 
about how to interpret symbols by words may not seem terribly difficult once you have 
the hang of it. In fact, it is not. And yet it is one of the deepest lessons of all of nineteenth 
century mathematics! It all begins with Euclid, who, around 300 B.C., compiled and 
systematized all of what was known about plane and solid geometry in his day. The 
resulting work, Euclid's Elements, was so solid that it was virtually a bible of geometry 
for over two thousand years-one of the most enduring works of all time. Why was this 

The principal reason was that Euclid was the founder of rigor in mathematics. The 
Elements began with very simple concepts, definitions, and so forth, and gradually built 
up a vast body of results organized in such a way that any given result depended only on 
foregoing results. Thus, there was a definite plan to the work, an architecture which made 
it strong and sturdy. 

Nevertheless, the architecture was of a different type from that of, say, a 
skyscraper. (See Fig. 21.) In the latter, that it is standing is proof enough that its structural 
elements are holding it up. But in a book on geometry, when each proposition is claimed 
to follow logically from earlier propositions, there will be no visible crash if one of the 
proofs is invalid. The girders and struts are not physical, but abstract. In fact, in Euclid's 
Elements, the stuff out of which proofs were constructed was human language-that 
elusive, tricky medium of communication with so many hidden pitfalls. What, then, of 
the architectural strength of the Elements? Is it certain that it is held up by solid structural 
elements, or could it have structural weaknesses? 

Every word which we use has a meaning to us, which guides us in our use of it. 
The more common the word, the more associations we have with it, and the more deeply 
rooted is its meaning. Therefore, when someone gives a definition for a common word in 
the hopes that we will abide by that 

Consistency, Completeness, and Geometry 


FIGURE 21. Tower of Babel, by M. C. Escher (woodcut, 1928). 

Consistency, Completeness, and Geometry 

definition, it is a foregone conclusion that we will not do so but will instead be guided, 
largely unconsciously, by what our minds find in their associative stores. I mention this 
because it is the sort of problem which Euclid created in his Elements, by attempting to 
give definitions of ordinary, common words such as "point", "straight line", "circle", and 
so forth. How can you define something of which everyone already has a clear concept? 
The only way is if you can make it clear that your word is supposed to be a technical 
term, and is not to be confused with the everyday word with the same spelling. You have 
to stress that the connection with the everyday word is only suggestive. Well, Euclid did 
not do this, because he felt that the points and lines of his Elements were indeed the 
points and lines of the real world. So by not making sure that all associations were 
dispelled, Euclid was inviting readers to let their powers of association run free ... 

This sounds almost anarchic, and is a little unfair to Euclid. He did set down 
axioms, or postulates, which were supposed to be used in the proofs of propositions. In 
fact, nothing other than those axioms and postulates was supposed to be used. But this is 
where he slipped up, for an inevitable consequence of his using ordinary words was that 
some of the images conjured up by those words crept into the proofs which he created. 
However, if you read proofs in the Elements, do not by any means expect to find glaring 
"jumps" in the reasoning. On the contrary, they are very subtle, for Euclid was a 
penetrating thinker, and would not have made any simpleminded errors. Nonetheless, 
gaps are there, creating slight imperfections in a classic work. But this is not to be 
complained about. One should merely gain an appreciation for the difference between 
absolute rigor and relative rigor. In the long run, Euclid's lack of absolute rigor was the 
cause of some of the most fertile path-breaking in mathematics, over two thousand years 
after he wrote his work. 

Euclid gave five postulates to be used as the "ground story" of the infinite 
skyscraper of geometry, of which his Elements constituted only the first several hundred 
stories. The first four postulates are rather terse and elegant: 

(1) A straight line segment can be drawn joining any two points. 

(2) Any straight line segment can be extended indefinitely in a straight line. 

(3) Given any straight line segment, a circle can be drawn having the segment as 

radius and one end point as center. 

(4) All right angles are congruent. 
The fifth, however, did not share their grace: 

(5) If two lines are drawn which intersect a third in such a way that the sum of the 

inner angles on one side is less than two right angles, then the two lines 
inevitably must intersect each other on that side if extended far enough 

Consistency, Completeness, and Geometry 


Though he never explicitly said so, Euclid considered this postulate to be somehow 
inferior to the others, since he managed to avoid using it in t proofs of the first twenty- 
eight propositions. Thus, the first twenty-eight propositions belong to what might be 
called "four-postulate geometry" that part of geometry which can be derived on the basis 
of the first to postulates of the Elements, without the help of the fifth postulate. (It is al 
often called absolute geometry.) Certainly Euclid would have found it 1 preferable to 
prove this ugly duckling, rather than to have to assume it. B he found no proof, and 
therefore adopted it. 

But the disciples of Euclid were no happier about having to assume this fifth 
postulate. Over the centuries, untold numbers of people ga untold years of their lives in 
attempting to prove that the fifth postulate s itself part of four-postulate geometry. By 
1763, at least twenty-eight deficient proofs had been published-all erroneous! (They were 
all criticized the dissertation of one G. S. Klugel.) All of these erroneous proofs involve a 
confusion between everyday intuition and strictly formal properties. It safe to say that 
today, hardly any of these "proofs" holds any mathematic or historical interest-but there 
are certain exceptions. 

The Many Faces of Noneuclid 

Girolamo Saccheri (1667-1733) lived around Bach's time. He had t ambition to 
free Euclid of every flaw. Based on some earlier work he h; done in logic, he decided to 
try a novel approach to the proof of the famous fifth: suppose you assume its opposite; 
then work with that as your fif postulate ... Surely after a while you will create a 
contradiction. Since i mathematical system can support a contradiction, you will have 
shown t unsoundness of your own fifth postulate, and therefore the soundness Euclid's 
fifth postulate. We need not go into details here. Suffice it to s that with great skill, 
Saccheri worked out proposition after proposition "Saccherian geometry" and eventually 
became tired of it. At one point, decided he had reached a proposition which was 
"repugnant to the nature of the straight line". That was what he had been hoping for- to his 
mind was the long-sought contradiction. At that point, he published his work under the 
title Euclid Freed of Every Flaw, and then expired. 

But in so doing, he robbed himself of much posthumous glory, sir he had 
unwittingly discovered what came later to be known as "hyperbolic geometry". Fifty 
years after Saccheri, J. H. Lambert repeated the "near miss", this time coming even 
closer, if possible. Finally, forty years after Lambert, and ninety years after Saccheri, 
non-Euclidean geometry was recognized for what it was-an authentic new brand of 
geometry, a bifurcation the hitherto single stream of mathematics. In 1823, non- 
Euclidean geometry was discovered simultaneously, in one of those inexplicable 
coincidences, by a Hungarian mathematician, Janos (or Johann) Bolyai, age twenty-one, 
and a Russian mathematician, Nikolay Lobachevskiy, ag thirty. And, ironically, in that 
same year, the great French mathematician 

Consistency, Completeness, and Geometry 


Adrien-Marie Legendre came up with what he was sure was a proof of Euclid's fifth 
postulate, very much along the lines of Saccheri. 

Incidentally, Bolyai's father, Farkas (or Wolfgang) Bolyai, a close friend of the 
great Gauss, invested much effort in trying to prove Euclid's fifth postulate. In a letter to 
his son Janos, he tried to dissuade him from thinking about such matters: 

You must not attempt this approach to parallels. I know this way to its very end. I have 
traversed this bottomless night, which extinguished all light and joy of my life. I entreat 
you, leave the science of parallels alone.... I thought I would sacrifice myself for the sake 
of the truth. I was ready to become a martyr who would remove the flaw from geometry 
and return it purified to mankind. I accomplished monstrous, enormous labors; my 
creations are far better than those of others and yet I have not achieved complete 
satisfaction. For here it is true that si paullum a summo discessit, vergit ad imum. I turned 
back when I saw that no man can reach the bottom of this night. I turned back unconsoled, 
pitying myself and all mankind.... I have traveled past all reefs of this infernal Dead Sea 
and have always come back with broken mast and torn sail. Fhe ruin of my disposition and 
my fall date back to this time. I thoughtlessly risked my life and happiness sut Caesar aut 
nihil. ' 

But later, when convinced his son really "had something", he urged him to 
publish it, anticipating correctly the simultaneity which is so frequent in scientific 

When the time is ripe for certain things, these things appear in different places in 
the manner of violets coming to light in early spring. 

How true this was in the case of non-Euclidean geometry! In Germany, Gauss 
himself and a few others had more or less independently hit upon non-Euclidean ideas. 
These included a lawyer, F. K. Schweikart, who in 1818 sent a page describing a new 
"astral" geometry to Gauss; Schweikart's nephew, F. A. Taurinus, who did non-Euclidean 
trigonometry; and F. L. Wachter, a student of Gauss, who died in 1817, aged twenty-five, 
having found several deep results in non-Euclidean geometry. 

The clue to non-Euclidean geometry was "thinking straight" about the 
propositions which emerge in geometries like Saccheri's and Lambert's. The Saccherian 
propositions are only "repugnant to the nature of the straight line" if you cannot free 
yourself of preconceived notions of what "straight line" must mean. If, however, you can 
divest yourself of those preconceived images, and merely let a "straight line" be 
something which satisfies the new propositions, then you have achieved a radically new 

Undefined Terms 

This should begin to sound familiar. In particular, it harks back to the pq-system, and its 
variant, in which the symbols acquired passive meanings by virtue of their roles in 
theorems. The symbol q is especially interesting, 

Consistency, Completeness, and Geometry 


since its "meaning" changed when a new axiom schema was added. In the very same 
way, one can let the meanings of "point", "line", and so on I determined by the set of 
theorems (or propositions) in which they occur. This was th great realization of the 
discoverers of non-Euclidean geometry. The found different sorts of non-Euclidean 
geometries by denying Euclid's fifth postulate in different ways and following out the 
consequences. Strict] speaking, they (and Saccheri) did not deny the fifth postulate 
directly, but rather, they denied an equivalent postulate, called the parallel postulate, 
which runs as follows: 

Given any straight line, and a point not on it, there exists one, and only one, straight 
line which passes through that point and never intersects the first line, no matter 
how far they are extended. 

The second straight line is then said to be parallel to the first. If you assert that no 
such line exists, then you reach elliptical geometry; if you assert that, at east two such 
lines exist, you reach hyperbolic geometry. Incidentally, tf reason that such variations are 
still called "geometries" is that the cot element-absolute, or four-postulate, geometry-is 
embedded in them, is the presence of this minimal core which makes it sensible to think 
of the] as describing properties of some sort of geometrical space, even if the spa( is not 
as intuitive as ordinary space. 

Actually, elliptical geometry is easily visualized. All "points", "lines and so forth 
are to be parts of the surface of an ordinary sphere. Let t write "POINT" when the 
technical term is meant, and "point" when tl everyday sense is desired. Then, we can say 
that a POINT consists of a pa of diametrically opposed points of the sphere's surface. A 
LINE is a great circle on the sphere (a circle which, like the equator, has its center at tl 
center of the sphere). Under these interpretations, the propositions ( elliptical geometry, 
though they contain words like "POINT" and "LINE speak of the goings-on on a sphere, 
not a plane. Notice that two LINT always intersect in exactly two antipodal points of the 
sphere's surface that is, in exactly one single POINT! And just as two LINES determine 
POINT, so two POINTS determine a LINE. 

By treating words such as "POINT" and "LINE" as if they had only tt meaning 
instilled in them by the propositions in which they occur, we take step towards complete 
formalization of geometry. This semiformal version still uses a lot of words in English 
with their usual meanings (words such "the", ' if ", "and", "join", "have"), although the 
everyday meaning has bee drained out of special words like "POINT" and "LINE", which 
are consequently called undefined terms. Undefined terms, like the p and q of th pq- 
system, do get defined in a sense: implicitly-by the totality of all propos dons in which 
they occur, rather than explicitly, in a definition. 

One could maintain that a full definition of the undefined tern resides in the 
postulates alone, since the propositions which follow from them are implicit in the 
postulates already. This view would say that the postulates are implicit definitions of all 
the undefined terms, all of the undefined terms being defined in terms of the others. 

Consistency, Completeness, and Geometry 


The Possibility of Multiple Interpretations 

A full formalization of geometry would take the drastic step of making every term 
undefined-that is, turning every term into a "meaningless" symbol of a formal system. I 
put quotes around "meaningless" because, as you know, the symbols automatically pick 
up passive meanings in accordance with the theorems they occur in. It is another 
question, though, whether people discover those meanings, for to do so requires finding a 
set of concepts which can be linked by an isomorphism to the symbols in the formal 
system. If one begins with the aim of formalizing geometry, presumably one has an 
intended interpretation for each symbol, so that the passive meanings are built into the 
system. That is what I did for p and q when I first created the pq-system. 

But there may be other passive meanings which are potentially perceptible, which 
no one has yet noticed. For instance, there were the surprise interpretations of p as 
"equals" and q as "taken from", in the original pq-system. Although this is rather a trivial 
example, it contains the essence of the idea that symbols may have many meaningful 
interpretations-it is up to the observer to look for them. 

We can summarize our observations so far in terms of the word "consistency". 
We began our discussion by manufacturing what appeared to be an inconsistent formal 
system-one which was internally inconsistent, as well as inconsistent with the external 
world. But a moment later we took it all back, when we realized our error: that we had 
chosen unfortunate interpretations for the symbols. By changing the interpretations, we 
regained consistency! It now becomes clear that consistency is not a property of a formal 
system per se, but depends on the interpretation which is proposed for it. By the same 
token, inconsistency is not an intrinsic property of any formal system. 

Varieties of Consistency 

We have been speaking of "consistency" and "inconsistency" all along, without 
defining them. We have just relied on good old everyday notions. But now let us say 
exactly what is meant by consistency of a formal system (together with an interpretation): 
that every theorem, when interpreted, becomes a true statement. And we will say that 
inconsistency occurs when there is at least one false statement among the interpreted 

This definition appears to be talking about inconsistency with the external world- 
what about internal inconsistencies? Presumably, a system would be internally 
inconsistent if it contained two or more theorems whose interpretations were 
incompatible with one another, and internally consistent if all interpreted theorems were 
compatible with one another. Consider, for example, a formal system which has only the 
following three theorems: TbZ, ZbE, and EbT. If T is interpreted as "the Tortoise", Z as 
"Zeno", E as "Egbert", and x by as "x beats y in chess always", then we have the 
following interpreted theorems: 

Consistency, Completeness, and Geometry 


The Tortoise always beats Zeno at chess 
Zeno always beats Egbert at chess. 
Egbert always beats the Tortoise at chess. 

The statements are not incompatible, although they describe a rather bizarre circle of 
chess players. Hence, under this interpretation, the form; system in which those three 
strings are theorems is internally consistent although, in point of fact, none of the three 
statements is true! Intern< consistency does not require all theorems to come out true, but 
merely that they come out compatible with one another. 

Now suppose instead that x by is to be interpreted as "x was invented by y". Then 
we would have: 

The Tortoise was invented by Zeno. 
Zeno was invented by Egbert. 
Egbert was invented by the Tortoise. 

In this case, it doesn't matter whether the individual statements are true c false-and 
perhaps there is no way to know which ones are true, and which are not. What is 
nevertheless certain is that not all three can be true at one Thus, the interpretation makes 
the system internally inconsistent. The internal inconsistency depends not on the 
interpretations of the three capital letters, but only on that of b, and on the fact that the 
three capita are cyclically permuted around the occurrences of b. Thus, one can have 
internal inconsistency without having interpreted all of the symbols of the formal system. 
(In this case it sufficed to interpret a single symbol.) By tl time sufficiently many symbols 
have been given interpretations, it may t clear that there is no way that the rest of them 
can be interpreted so that a theorems will come out true. But it is not just a question of 
truth-it is question of possibility. All three theorems would come out false if the capitals 
were interpreted as the names of real people-but that is not why we would call the system 
internally inconsistent; our grounds for doing s would be the circularity, combined with 
the interpretation of the letter I (By the way, you'll find more on this "authorship triangle" 
in Chapter XX.; 

Hypothetical Worlds and Consistency 

We have given two ways of looking at consistency: the first says that system- 
plus-interpretation is consistent with the external world if every theorem comes out true 
when interpreted; the second says that a system-plus: interpretation is internally 
consistent if all theorems come out mutually compatible when interpreted. Now there is a 
close relationship between these two types of consistency. In order to determine whether 
several statements at mutually compatible, you try to imagine a world in which all of 
them could be simultaneously true. Therefore, internal consistency depends upon 
consistency with the external world-only now, "the external world" allowed to be any 
imaginable world, instead of the one we live in. But this is 

Consistency, Completeness, and Geometry 


an extremely vague, unsatisfactory conclusion. What constitutes an "imaginable" world? 
After all, it is possible to imagine a world in which three characters invent each other 
cyclically. Or is it? Is it possible to imagine a world in which there are square circles? Is a 
world imaginable in which Newton's laws, and not relativity, hold? Is it possible to 
imagine a world in which something can be simultaneously green and not green? Or a 
world in which animals exist which are not made of cells? In which Bach improvised an 
eight-part fugue on a theme of King Frederick the Great? In which mosquitoes are more 
intelligent than people? In which tortoises can play football-or talk? A tortoise talking 
football would be an anomaly, of course. 

Some of these worlds seem more imaginable than others, since some seem to 
embody logical contradictions-for example, green and not green-while some of them 
seem, for want of a better word, "plausible" — such as Bach improvising an eight-part 
fugue, or animals which are not made of cells. Or even, come to think of it, a world in 
which the laws of physics are different ... Roughly, then, it should be possible to establish 
different brands of consistency. For instance, the most lenient would be "logical 
consistency", putting no restraints on things at all, except those of logic. More 
specifically, a system-plus-interpretation would be logically consistent just as long as no 
two of its theorems, when interpreted as statements, directly contradict each other; and 
mathematically consistent just as long as interpreted theorems do not violate 
mathematics; and physically consistent just as long as all its interpreted theorems are 
compatible with physical law; then comes biological consistency, and so on. In a 
biologically consistent system, there could be a theorem whose interpretation is the 
statement "Shakespeare wrote an opera", but no theorem whose interpretation is the 
statement "Cell-less animals exist". Generally speaking, these fancier kinds of 
inconsistency are not studied, for the reason that they are very hard to disentangle from 
one another. What kind of inconsistency, for example, should one say is involved in the 
problem of the three characters who invent each other cyclically? Logical? Physical? 
Biological? Literary? 

Usually, the borderline between uninteresting and interesting is drawn between 
physical consistency and mathematical consistency. (Of course, it is the mathematicians 
and logicians who do the drawing-hardly an impartial crew . . .) This means that the kinds 
of inconsistency which "count", for formal systems, are just the logical and mathematical 
kinds. According to this convention, then, we haven't yet found an interpretation which 
makes the trio of theorems TbZ, ZbE, EbT inconsistent. We can do so by interpreting b 
as "is bigger than". What about T and Z and E? They can be interpreted as natural 
numbers-for example, Z as 0, T as 2, and E as 11. Notice that two theorems come out 
true this way, one false. If, instead, we had interpreted Z as 3, there would have been two 
falsehoods and only one truth. But either way, we'd have had inconsistency. In fact, the 
values assigned to T, Z, and E are irrelevant, as long as it is understood that they are 
restricted to natural numbers. Once again we see a case where only some of the 
interpretation is needed, in order to recognize internal inconsistency. 

Consistency, Completeness, and Geometry 


Embedding of One Formal System In Another 

The preceding example, in which some symbols could have interpretations while others 
didn't, is reminiscent of doing geometry in natural languag4 using some words as 
undefined terms. In such a case, words are divide into two classes: those whose meaning 
is fixed and immutable, and, those whose meaning is to be adjusted until the system is 
consistent (these are th undefined terms). Doing geometry in this way requires that 
meanings have already been established for words in the first class, somewhere outside c 
geometry. Those words form a rigid skeleton, giving an underlying structure to the 
system; filling in that skeleton comes other material, which ca vary (Euclidean or non- 
Euclidean geometry). 

Formal systems are often built up in just this type of sequential, c hierarchical, 
manner. For example, Formal System I may be devised, wit rules and axioms that give 
certain intended passive meanings to its symbol Then Formal System I is incorporated 
fully into a larger system with more symbols-Formal System II. Since Formal System I's 
axioms and rules at part of Formal System II, the passive meanings of Formal System I 
symbols remain valid; they form an immutable skeleton which then plays large role in the 
determination of the passive meanings of the new symbols of Formal System II. The 
second system may in turn play the role of skeleton with respect to a third system, and so 
on. It is also possible-an geometry is a good example of this-to have a system (e.g., 
absolute geometry) which partly pins down the passive meanings of its undefined terms, 
and which can be supplemented by extra rules or axioms, which then further restrict the 
passive meanings of the undefined terms. This the case with Euclidean versus non- 
Euclidean geometry. 

Layers of Stability in Visual Perception 

In a similar, hierarchical way, we acquire new knowledge, new vocabulary or 
perceive unfamiliar objects. It is particularly interesting in the case understanding 
drawings by Escher, such as Relativity (Fig. 22), in which there occur blatantly 
impossible images. You might think that we won seek to reinterpret the picture over and 
over again until we came to interpretation of its parts which was free of contradictions- 
but we dot do that at all. We sit there amused and puzzled by staircases which go eve 
which way, and by people going in inconsistent directions on a sing staircase. Those 
staircases are "islands of certainty" upon which we base of interpretation of the overall 
picture. Having once identified them, we try extend our understanding, by seeking to 
establish the relationship which they bear to one another. At that stage, we encounter 
trouble. But if i attempted to backtrack-that is, to question the "islands of certainty"-s 
would also encounter trouble, of another sort. There's no way of backtracking and 
"undeciding" that they are staircases. They are not fishes, or whip or hands-they are just 
staircases. (There is, actually, one other on t-i leave all the lines of the picture totally 
uninterpreted, like the "meaningless 

Consistency, Completeness, and Geometry 


FIGURE 22. Relativity, by M. C. Escher (lithograph, 1953). 

symbols" of a formal system. This ultimate escape route is an example of a "U-mode" 
response-a Zen attitude towards symbolism.) 

So we are forced, by the hierarchical nature of our perceptive processes, to see 
either a crazy world or just a bunch of pointless lines. A similar analysis could be made 
of dozens of Escher pictures, which rely heavily upon the recognition of certain basic 
forms, which are then put together in nonstandard ways; and by the time the observer 
sees the paradox on a high level, it is too late-he can't go back and change his mind about 
how to interpret the lower-level objects. The difference between an Escher drawing and 
non-Euclidean geometry is that in the latter, comprehensible interpretations can be found 
for the undefined terms, resulting in a com 

Consistency, Completeness, and Geometry 


prehensible total system, whereas for the former, the end result is not reconcilable with 
one's conception of the world, no matter how long or stares at the pictures. Of course, one 
can still manufacture hypothetic worlds, in which Escherian events can happen ... but in 
such worlds, tl laws of biology, physics, mathematics, or even logic will be violated on 
or level, while simultaneously being obeyed on another, which makes the: extremely 
weird worlds. (An example of this is in Waterfall (Fig. 5), whet normal gravitation 
applies to the moving water, but where the nature space violates the laws of physics.) 

Is Mathematics the Same in Every Conceivable World? 

We have stressed the fact, above, that internal consistency of a form; system (together 
with an interpretation) requires that there be some imaginable world-that is, a world 
whose only restriction is that in it, mathematics and logic should be the same as in our 
world-in which all the interpreted theorems come out true. External consistency, however 
consistency with the external world-requires that all theorems come of true in the real 
world. Now in the special case where one wishes to create consistent formal system 
whose theorems are to be interpreted as statements of mathematics, it would seem that 
the difference between the two types of consistency should fade away, since, according to 
what we sat above, all imaginable worlds have the same mathematics as the real world. 
Thus, i every conceivable world, 1 plus 1 would have to be 2; likewise, there would have 
to be infinitely many prime numbers; furthermore, in every conceivable world, all right 
angles would have to be congruent; and of cours4 through any point not on a given line 
there would have to be exactly on parallel line ... 

But wait a minute! That's the parallel postulate-and to assert i universality would 
be a mistake, in light of what's just been said. If in all conceivable worlds the parallel 
postulate-is obeyed, then we are asserting that non-Euclidean geometry is inconceivable, 
which puts us back in the same mental state as Saccheri and Lambert-surely an unwise 
move. But what, then, if not all of mathematics, must all conceivable worlds share? 
Could it I as little as logic itself? Or is even logic suspect? Could there be worlds where 
contradictions are normal parts of existence-worlds where contradictious are not 

Well, in some sense, by merely inventing the concept, we have shoe that such 
worlds are indeed conceivable; but in a deeper sense, they are al: quite inconceivable. 
(This in itself is a little contradiction.) Quite serious] however, it seems that if we want to 
be able to communicate at all, we ha, to adopt some common base, and it pretty well has 
to include logic. (The are belief systems which reject this point of view-it is too logical, 
particular, Zen embraces contradictions and non-contradictions with equ eagerness. This 
may seem inconsistent, but then being inconsistent is pa of Zen, and so ... what can one 

Consistency, Completeness, and Geometry 


Is Number Theory the Same In All Conceivable Worlds? 

If we assume that logic is part of every conceivable world (and note that we have 
not defined logic, but we will in Chapters to come), is that all? Is it really conceivable 
that, in some worlds, there are not infinitely many primes? Would it not seem necessary 
that numbers should obey the same laws in all conceivable worlds? Or ... is the concept 
"natural number" better thought of as an undefined term, like "POINT" or "LINE"? In 
that case, number theory would be a bifurcated theory, like geometry: there would be 
standard and nonstandard number theories. But there would have to be some counterpart 
to absolute geometry: a "core" theory, an invariant ingredient of all number theories 
which identified them as number theories rather than, say, theories about cocoa or rubber 
or bananas. It seems to be the consensus of most modern mathematicians and 
philosophers that there is such a core number theory, which ought to be included, along 
with logic, in what we consider to be "conceivable worlds". This core of number theory, 
the counterpart to absolute geometry-is called Peano arithmetic, and we shall formalize it 
in Chapter VIII. Also, it is now well established-as a matter of fact as a direct 
consequence of Godel's Theorem- that number theory is a bifurcated theory, with 
standard and nonstandard versions. Unlike the situation in geometry, however, the 
number of "brands" of number theory is infinite, which makes the situation of number 
theory considerably more complex. 

For practical purposes, all number theories are the same. In other words, if bridge 
building depended on number theory (which in a sense it does), the fact that there are 
different number theories would not matter, since in the aspects relevant to the real world, 
all number theories overlap. The same cannot be said of different geometries; for 
example, the sum of the angles in a triangle is 180 degrees only in Euclidean geometry; it 
is greater in elliptic geometry, less in hyperbolic. There is a story that Gauss once 
attempted to measure the sum of the angles in a large triangle defined by three mountain 
peaks, in order to determine, once and for all, which kind of geometry really rules our 
universe. It was a hundred years later that Einstein gave a theory (general relativity) 
which said that the geometry of the universe is determined by its content of matter, so 
that no one geometry is intrinsic to space itself. Thus to the question, "Which geometry is 
true?" nature gives an ambiguous answer not only in mathematics, but also in physics. As 
for the corresponding question, "Which number theory is true?", we shall have more to 
say on it after going through Godel's Theorem in detail. 


If consistency is the minimal condition under which symbols acquire passive meanings, 
then its complementary notion, completeness, is the maximal confirmation of those 
passive meanings. Where consistency is the property 

Consistency, Completeness, and Geometry 


way round: "Every true statement is produced by the system". Now I refine the notion 
slightly. We can't mean every true statement in th world-we mean only those which 
belong to the domain which we at attempting to represent in the system. Therefore, 
completeness mean! "Every true statement which can be expressed in the notation of the 
system is a theorem." 

Consistency: when every theorem, upon interpretation, comes out true (in some 
imaginable world). 

Completeness: when all statements which are true (in some imaginable world), and 
which can be expressed as well-formed strings of the system, are 

An example of a formal system which is complete on its own mode level is the 
original pq-system, with the original interpretation. All true additions of two positive 
integers are represented by theorems of th system. We might say this another way: "All 
true additions of two positive integers are provable within the system." (Warning: When 
we start using th term "provable statements" instead of "theorems", it shows that we at 
beginning to blur the distinction between formal systems and their interpretations. This is 
all right, provided we are very conscious of th blurring that is taking place, and provided 
that we remember that multiple interpretations are sometimes possible.) The pq-system 
with the origin interpretation is complete; it is also consistent, since no false statement is-, 
use our new phrase-provable within the system. 

Someone might argue that the system is incomplete, on the grounds that additions 
of three positive integers (such as 2 + 3 + 4 =9) are not represented by theorems of the 
pq-system, despite being translatable into the notation of the system (e.g., — p — p — q — 

). However, this string is not well-formed, and hence should be considered to I just 

as devoid of meaning as is p q p — q p q. Triple additions are simply not expressible in 
the notation of the system-so the completeness of the system is preserved. 

Despite the completeness of the pq-system under this interpretation, certainly falls 
far short of capturing the full notion of truth in numb theory. For example, there is no 
way that the pq-system tells us how mat prime numbers there are. Godel's 
Incompleteness Theorem says that any system which is "sufficiently powerful" is, by 
virtue of its power, incomplete, in the sense that there are well-formed strings which 
express tr statements of number theory, but which are not theorems. (There a truths 
belonging to number theory which are not provable within the system.) Systems like the 
pq-system, which are complete but not very powerful, are more like low-fidelity 
phonographs; they are so poor to beg with that it is obvious that they cannot do what we 
would wish them do-namely tell us everything about number theory. 

Consistency, Completeness, and Geometry 


How an Interpretation May Make or Break Completeness 

What does it mean to say, as I did above, that "completeness is the maximal confirmation 
of passive meanings"? It means that if a system is consistent but incomplete, there is a 
mismatch between the symbols and their interpretations. The system does not have the 
power to justify being interpreted that way. Sometimes, if the interpretations are 
"trimmed" a little, the system can become complete. To illustrate this idea, let's look at 
the modified pq-system (including Axiom Schema II) and the interpretation we used for 

After modifying the pq-system, we modified the interpretation for q from "equals" 
to "is greater than or equal to". We saw that the modified pq-system was consistent under 
this interpretation; yet something about the new interpretation is not very satisfying. The 
problem is simple: there are now many expressible truths which are not theorems. For 
instance, "2 plus 3 is greater than or equal to 1" is expressed by the nontheorem ~p — q-. 
The interpretation is just too sloppy! It doesn't accurately reflect what the theorems in the 
system do. Under this sloppy interpretation, the pq-system is not complete. We could 
repair the situation either by (1) adding new rules to the system, making it more 
powerful, or by (2) tightening up the interpretation. In this case, the sensible alternative 
seems to be to tighten the interpretation. Instead of interpreting q as "is greater than or 
equal to", we should say "equals or exceeds by 1". Now the modified pq-system becomes 
both consistent and complete. And the completeness confirms the appropriateness of the 

Incompleteness of Formalized Number Theory 

In number theory, we will encounter incompleteness again; but there, to remedy the 
situation, we will be pulled in the other direction-towards adding new rules, to make the 
system more powerful. The irony is that we think, each time we add a new rule, that we 
surely have made the system complete nowl The nature of the dilemma can be illustrated' 
by the following allegory ... 

We have a record player, and we also have a record tentatively labeled "Canon on 
B-A-C-H". However, when we play the record on the record player, the feedback- 
induced vibrations (as caused by the Tortoise's records) interfere so much that we do not 
even recognize the tune. We conclude that something is defective-either our record, or 
our record player. In order to test our record, we would have to play it on friends' record 
players, and listen to its quality. In order to test our phonograph, we would have to play 
friends' records on it, and see if the music we hear agrees with the labels. If our record 
player passes its test, then we will say the record was defective; contrariwise, if the 
record passes its test, then we will say our record player was defective. What, however, 
can we conclude when we find out that both pass their respective tests? That is the 
moment to remember the chain of two isomorphisms (Fig. 20), and think carefully! 

Consistency, Completeness, and Geometry 


Little Harmonic Labyrinth 

The Tortoise and Achilles are spending a day at Coney Island After buying a 
couple of cotton candies, they decide to take a ride on the Ferris wheel. 

Tortoise: This is my favorite ride. One seems to move so far, and 
reality one gets nowhere. 

Achilles: I can see why it would appeal to you. Are you all strapped in? 
Tortoise: Yes, I think I've got this buckle done. Well, here we go. 
Achilles: You certainly are exuberant today. 

Tortoise: I have good reason to be. My aunt, who is a fortune-teller me that a stroke of 

Good Fortune would befall me today. So I am tingling with anticipation. 
Achilles: Don't tell me you believe in fortune-telling! 
Tortoise: No ... but they say it works even if you don't believe ii 
Achilles: Well, that's fortunate indeed. 

Tortoise: Ah, what a view of the beach, the crowd, the ocean, the city. . . 

Achilles: Yes, it certainly is splendid. Say, look at that helicopter there. It seems to be 

flying our way. In fact it's almost directly above us now. 
Tortoise: Strange-there's a cable dangling down from it, which is very close to us. It's 

coming so close we could practically grab it 
Achilles: Look! At the end of the line there's a giant hook, with a note 

(He reaches out and snatches the note. They pass by and are on their z down.) 

Tortoise: Can you make out what the note says? 

Achilles: Yes-it reads, "Howdy, friends. Grab a hold of the hook time around, for an 
Unexpected Surprise." 

Tortoise: The note's a little corny but who knows where it might lead, Perhaps it's got 

something to do with that bit of Good Fortune due me. By all means, let's try it! 
Achilles: Let's! 

(On the trip up they unbuckle their buckles, and at the crest of the ride, grab for the 
giant hook. All of a sudden they are whooshed up by the ca which quickly reels 
them skyward into the hovering helicopter. A It strong hand helps them in.) 

Voice: Welcome aboard-Suckers. 
Achilles: Wh-who are you? 

Little Harmonic Labyrinth 


Voce: Allow me to introduce myself. I am Hexachlorophene J. Goodforttune, Kidnapper 

At-Large, and Devourer of Tortoises par Excellence, at your service. 
Tortoise: Gulp! 

Achilles {whispering to his friend): Uh-oh-I think that this "Goodfortune" is not exactly 
what we'd anticipated. (To Goodfortune) Ah-if I may be so bold-where are you 
spiriting us off to? 

Goodfortune: Ho ho! To my all-electric kitchen- in-the-sky, where I will prepare THIS 
tasty morsel-(/eermg at the Tortoise as he says this)-'m a delicious pie-in-the-sky! 
And make no mistake-it's all just for my gobbling pleasure! Ho ho ho! 

Achilles: All I can say is you've got a pretty fiendish laugh. 

Goodfortune {laughing fiendishly): Ho ho ho! For that remark, my friend, you will pay 

dearly. Ho ho! 
Achilles: Good grief-I wonder what he means by that! 

Goodfortune: Very simple -I've got a Sinister Fate in store for both of you! Just you wait! 

Ho ho ho! Ho ho ho! 
Achilles: Yikes! 

Goodfortune: Well, we have arrived. Disembark, my friends, into my fabulous all-electric 

(They walk inside.) 

Let me show you around, before I prepare your fates. Here is my bedroom. Here is 
my study. Please wait here for me for a moment. I've got to go sharpen my knives. 
While you're waiting, help yourselves to some popcorn. Ho ho ho! Tortoise pie! 
Tortoise pie! My favorite kind of pie! (Exit.) 

Achilles: Oh, boy-popcorn! I'm going to munch my head off! 

Tortoise: Achilles! You just stuffed yourself with cotton candy! Besides, how can you 

think about food at a time like this? 
Achilles: Good gravy-oh, pardon me -I shouldn't use that turn of phrase, should I? I mean 

in these dire circumstances ... Tortoise: I'm afraid our goose is cooked. 
Achilles: Say-take a gander at all these books old Goodfortune has in his study. Quite a 

collection of esoterica: Birdbrains I Have Known; Chess and Umbrella-Twirling 

Made Easy; Concerto for Tapdancer and Orchestra ... Hmmm. 
Tortoise: What's that small volume lying open over there on the desk, next to the 

dodecahedron and the open drawing pad? 
Achilles: This one? Why, its title is Provocative Adventures of Achilles and the Tortoise 

Taking Place in Sundry Spots of the Globe. Tortoise: A moderately provocative 


Achilles: Indeed-and the adventure it's opened to looks provocative. It's called "Djinn and 

Tortoise: Hmm ... I wonder why. Shall we try reading it? I could take the Tortoise's part, 
and you could take that of Achilles. 

Little Harmonic Labyrinth 


Achilles: I'm game. Here goes nothing . . . 

(They begin reading "Djinn and Tonic".) 

(Achilles has invited the Tortoise over to see his collection of prints by 
his favorite artist, M. C. Escher.) 

Tortoise: These are wonderful prints, Achilles. 

Achilles: I knew you would enjoy seeing them. Do you have any particular 

Tortoise: One of my favorites is Convex and Concave, where two internally 
consistent worlds, when juxtaposed, make a completely inconsistent 
composite world. Inconsistent worlds are always fun places to visit, 
but I wouldn't want to live there. 

Achilles: What do you mean, "fun to visit"? Inconsistent worlds don't EXIST, 
so how can you visit one? 

Tortoise: I beg your pardon, but weren't we just agreeing that in 

this Escher picture, an inconsistent world is portrayed? 

Achilles: Yes, but that's just a two-dimensional world-a fictitious world-a 

picture. You can't visit that world. 
Tortoise: I have my ways ... 

Achilles: How could you propel yourself into a flat picture-universe? 
Tortoise: By drinking a little glass of PUSHING-POTION. That does the 

Achilles: What on earth is pushing-potion? 

Tortoise: It's a liquid that comes in small ceramic phials, and which, when 
drunk by someone looking at a picture, "pushes" him right into the 
world of that picture. People who aren't aware of the powers of 
pushing-potion often are pretty surprised by the situations they wind 
up in. 

Achilles: Is there no antidote? Once pushed, is one irretrievably lost? 
Tortoise: In certain cases, that's not so bad a fate. But there is, in fact, another 

potion-well, not a potion, actually, but an elixir-no, not an elixir, but 


Tortoise: He probably means "tonic". 
Achilles: Tonic? 

Tortoise: That's the word I was looking for! "POPPING-TONIC" iu what it's 
called, and if you remember to carry a bottle of it in your right hand as 
you swallow the pushing-potion, it too will be pushed into the picture; 
then, whenever you get a hanker ing to "pop" back out into real life, 
you need only take a swallow of popping-tonic, and presto! You're 
back in the rea. world, exactly where you were before you pushed 
yourself in. 

Achilles: That sounds very interesting. What would happen it you took some 
popping-tonic without having previously pushed yourself into a 

Little Harmonic Labyrinth 


Tortoise: I don't precisely know, Achilles, but I would be rather wary of 
horsing around with these strange pushing and popping liquids. Once I 
had a friend, a Weasel, who did precisely what you suggested-and no 
one has heard from him since. 

Achilles: That's unfortunate. Can you also carry along the bottle of pushing- 
potion with you? 

Tortoise: Oh, certainly. Just hold it in your left hand, and it too will get 
pushed right along with you into the picture you're looking at. 

Achilles: What happens if you then find a picture inside the picture which you 
have already entered, and take another swig of pushing-potion? 

Tortoise: Just what you would expect: you wind up inside that picture-in-a- 

Achilles: I suppose that you have to pop twice, then, in order to extricate 
yourself from the nested pictures, and re-emerge back in real life. 

Tortoise: That's right. You have to pop once for each push, since a push takes 
you down inside a picture, and a pop undoes that. 

Achilles: You know, this all sounds pretty fishy to me . . . Are you sure you're 
not just testing the limits of my gullibility? 

Tortoise: I swear! Look-here are two phials, right here in my pocket. 
{Reaches into his lapel pocket, and pulls out two rather large 
unlabeled phials, in one of which one can hear a red liquid sloshing 
around, and in the other of which one can hear a blue liquid sloshing 
around.) If you're willing, we can try them. What do you say? 

Achilles: Well, I guess, ahm, maybe, ahm ... 

Tortoise: Good! I knew you'd want to try it out. Shall we push ourselves into 

the world of Escher's Convex and Concavel 
Achilles: Well, ah, .. . 

Tortoise: Then it's decided. Now we've got to remember to take along this 
flask of tonic, so that we can pop back out. Do you want to take that 
heavy responsibility, Achilles? 

Achilles: If it's all the same to you, I'm a little nervous, and I'd prefer letting 
you, with your experience, manage the operation. 

Tortoise: Very well, then. 

(So saying, the Tortoise pours two small portions of pushing-potion. Then 
he picks up the flask of tonic and grasps it firmly in his right hand, and 
both he and Achilles lift their glasses to their lips.) 

Tortoise: Bottoms up! 

( They swallow.) 

Little Harmonic Labyrinth 


FIGURE 23. Convex and Concave, by M. C. Escher (lithograph, 1955). 

Achilles: That's an exceedingly strange taste. 
Tortoise: One gets used to it. 

Achilles: Does taking the tonic feel this strange? Tortoise: Oh, that's quite 
another sensation. Whenever you taste the tonic, you feel a deep sense 
of satisfaction, as if you'd been waiting to taste it all your life. 
Achilles: Oh, I'm looking forward to that. Tortoise: Well, Achilles, 
where are we? 

Achilles {taking cognizance of his surroundings): We're in a little gondola, 
gliding down a canal! I want to get out. Mr. Gondolier, please let us 
out here. 

(The gondolier pays no attention to this request.) 

Tortoise: He doesn't speak English. If we want to get out here, we'd better just 
clamber out quickly before he 

Little Harmonic Labyrinth 


Enters the sinister "Tunnel of Love"; just ahead of us. 

(Achilles, his face a little pale scrambles out in a split second and then 
pulls his slower friend out.) 

Achilles: I didn't like the sound of that place, somehow. I'm glad we got out 

here. Say, how do you know so much about this place, anyway? Have 

you been here before? 
Tortoise: Many times, although I always came in from other Escher pictures. 

They're all connected behind the frames, you know. Once you're in 

one, you can get to any other one. 
Achilles: Amazing! Were I not here, seeing these things with my own eyes, 

I'm not sure I'd believe you. (They wander out through a little arch.) 

Oh, look at those two cute lizards! 
Tortoise: Cute? They aren't cute-it makes me shudder just to think of them! 

They are the vicious guardians of that magic copper lamp hanging 

from the ceiling over there. A mere touch of their tongues, and any 

mortal turns to a pickle. 
Achilles: Dill, or sweet? 
Tortoise: Dill. 

Achilles: Oh, what a sour fate! But if the lamp has magical powers, I would 

like to try for it. 
Tortoise: It's a foolhardy venture, my friend. I wouldn't risk it. 
Achilles: I'm going to try just once. 

(He stealthily approaches the lamp, making sure not to awaken the 
sleeping lad nearby. But suddenly, he slips on a strange shell-like 
indentation in the floor, and lunges out into space. Lurching crazily, he 
reaches for anything, and manages somehow to grab onto the lamp with 
one hand. Swinging wildly, with both lizards hissing and thrusting their 
tongues violently out at him, he is left dangling helplessly out in the middle 
of space.) 

Achilles: He-e-e-elp! 

(His cry attracts the attention of a woman who rushes downstairs and 
awakens the sleeping boy. He takes stock of the situation, and, with a 
kindly smile on his face, gestures to Achilles that all will be well. He shouts 
something in a strange guttural tongue to a pair of trumpeters high up in 
windows, and immediately, 

Little Harmonic Labyrinth 


Weird tones begin ringing out and making beats each other. The sleepy 
young lad points at the lizards, and Achilles sees that the music is having a 
strong soporific effect on them. Soon, they are completely unconscious. 
Then the helpful lad shouts to two companions climbing up ladders. They 
both pull their ladders up and then extend them out into space just 
underneath the stranded Achilles, forming a sort of bridge. Their gestures 
make it clear that Achilles should hurry and climb on. But before he does 
so, Achilles carefully unlinks the top link of the chain holding the lamp, and 
detaches the lamp. Then he climbs onto the ladder-bridge and the three 
young lads pull him in to safety. Achilles throws his arms around them and 
hugs them gratefully.) 

Achilles: Oh, Mr. T, how can I repay them? 

Tortoise: I happen to know that these valiant lads just love coffee, and down 
in the town below, there's a place where they make an incomparable 
cup of espresso. Invite them for a cup of espresso! Achilles: That 
would hit the spot. 

(And so, by a rather comical series of gestures, smiles, and words, Achilles 
manages to convey his invitation to the young lads, and the party of five 
walks out and down a steep staircase descending into the town. They reach 
a charming small cafe, sit down outside, and order five espressos. As they 
sip their drinks, Achilles remembers he has the lamp with him.) 

Achilles: I forgot, Mr. Tortoise-I've got this ma; lamp with me! But- what's 
magic about it? Tortoise: Oh, you know, just the usual-a genie. 

Achilles: What? You mean a genie comes out when you rub it, and grants you 

Tortoise: Right. What did you expect? Pennies fry heaven? 
Achilles: Well, this is fantastic! I can have any wish want, eh? I've always 
wished this would happen to me ... 

(And so Achilles gently rubs the large letter X' which is etched on the 
lamp's copper surface ... Suddenly a huge puff of smoke appears, and in the 
forms of the smoke the five friends can make out a weird, ghostly figure 
towering above them.) 

Little Harmonic Labyrinth 



Genie: Hello, my friends - and thanks ever so much for rescuing my Lamp 
from the evil Lizard-Duo. 

(And so saying, the Genie picks up the Lamp, and stuffs it into a pocket 
concealed among the folds of his long ghostly robe which swirls out of the 

As a sign of gratitude for your heroic deed, I would like to offer you, on the 
part of my Lamp, the opportunity to have any three of your wishes 

Achilles: How stupefying! Don't you think so, Mr. T? 

Tortoise: I surely do. Go ahead, Achilles, take the first wish. 

Achilles: Wow! But what should I wish? Oh, I know! It's what I thought of 
the first time I read the Arabian Nights (that collection of silly (and 
nested) tales)-I wish that I had a HUNDRED wishes, instead of just 
three! Pretty clever, eh, Mr. T? I bet YOU never would have thought 
of that trick. I always wondered why those dopey people in the stories 
never tried it themselves. 

Tortoise: Maybe now you'll find out the answer. 

Genie: I am sorry, Achilles, but I don't grant metawishes. 

Achilles: I wish you'd tell me what a "meta-wish" is! 

Genie: But THAT is a meta-meta-wish, Achilles-and I don't grant them, 

either. Achilles: Whaaat? I don't follow you at all. 
Tortoise: Why don't you rephrase your last request, Achilles? 
Achilles: What do you mean? Why should I? 

Tortoise: Well, you began by saying "I wish". Since you're just asking for 
information, why don't you just ask a question? 

Achilles: All right, though I don't see why. Tell me, Mr. Genie-what is a 
meta-wish? Genie: It is simply a wish about wishes. I am not allowed 
to grant meta-wishes. It is only within my purview to grant plain 
ordinary wishes, such as wishing for ten bottles of beer, to have Helen 
of Troy on a blanket, or to have an all-expenses-paid weekend for two 
at the Copacabana. You know-simple things like that. But meta- 
wishes I cannot grant. GOD won't permit me to. 

Achilles: GOD? Who is GOD? And why won't he let you grant meta-wishes? 
That seems like such a puny thing compared to the others you 

Little Harmonic Labyrinth 


Genie: Well, it's a complicated matter, you see. Why don't you just go ahead 
and make your three wishes? Or at least make one of them. I don't 
have all I time in the world, you know ... 

Achilles: Oh, I feel so rotten. I was REALLY HOPING wish for a hundred 
wishes ... 

Genie: Gee, I hate to see anybody so disappointed that. And besides, meta- 
wishes are my favorite k of wish. Let me just see if there isn't anything 
I do about this. This'll just take one moment 

( The Genie removes from the wispy folds of his robe an object which looks 
just like the copper Lamp he had put away, except that this one is made of 
silver; and where the previous one had L ' etched on it, this one has ML ' in 
smaller letters, so as to cover the same area.) 


Achilles: And what is that? 
Genie: This is my Meta-Lamp ... 

(He rubs the Meta-Lamp, and a huge puff of smoke appears. In the billows 
of smoke, they can all make out a ghostly form towering above them.) 

Meta-Genie: I am the Meta-Genie. You summoned me, 0 Genie? What is 
your wish? 

Genie: I have a special wish to make of you, 0 Djinn and of GOD. I wish for 
permission for tempos suspension of all type-restrictions on wishes, 
for duration of one Typeless Wish. Could you ph grant this wish for 

Meta-Genie: I'll have to send it through Channels, of course. One half a 
moment, please 

(And, twice as quickly as the Genie did, this Meta-Genie removes from the 
wispy folds of her robe an object which looks just like the silver Meta- 
Lamp, except that it is made of gold; and where the previous one had ML ' 
etched on it, this one has 'MML ' in smaller letters, so as to cover the same 

Achilles (his voice an octave higher than before): And what is that? Meta- 
Genie: This is my Meta-Meta-Lamp. . . 

(She rubs the Meta-Meta-Lamp, and a hugs puff of smoke appears. In the 
billows o smoke, they can all make out a ghostly fore towering above 

Little Harmonic Labyrinth 


Meta-Meta-Genie: I am the MetaM eta-Genie. You summoned me, 
0 Meta-Genie? What is your wish? 

Meta-Genie: I have a special wish to make of you, 0 Djinn, and of GOD. I 
wish for permission for temporary suspension of all type-restrictions 
on wishes, for the duration of one Typeless Wish. Could you please 
grant this wish for me? 

Meta-Meta-Genie: I'll have to send it through Channels, of course. 
One quarter of a moment, please. 

(And, twice as quickly as the Meta-Genie did, this MetaMeta- 
Genie removes from the folds of his robe an object which looks 
just like the gold MetaLamp, except that it is made of ...) 

. .{GOD} 

( ... swirls back into the MetaM eta-Meta-Lamp, which the Meta- 
Meta-Genie then folds back into his robe, half as quickly as the 
Meta-Meta-Meta-Genie did.) 

Your wish is granted, 0 MetaGenie. 

Meta-Genie: Thank you, 0 Djinn, and GOD. 

(And the Meta-Meta-Genie, as all the higher ones before him, swirls 
back into the Meta-Meta-Lamp, which the Meta-Genie then folds back 
into her robe, half as quickly as the Meta-Meta-Genie did.) 

Your wish is granted, 0 Genie. 
Genie: Thank you, 0 Djinn, and GOD. 

(And the Meta-Genie, as all the higher ones before her, 

Little Harmonic Labyrinth 


swirls back into the Meta-Lamp, which the Genie folds back into his robe, 
half as quickly as the M Genie did.) 

Your wish is granted, Achilles. 

(And one precise moment has elapsed since he "This will just take one 
moment. ") 

Achilles: Thank you, 0 Djinn, and GOD. 

Genie: I am pleased to report, Achilles, that you r have exactly one (1) 
Typeless Wish-that is to sa wish, or a meta-wish, or a meta-meta-wish, 
as many "meta"'s as you wish-even infinitely many (if wish). 

Achilles: Oh, thank you so very much, Genie. But curiosity is provoked. 
Before I make my wish, would you mind telling me who-or what- 

Genie: Not at all. "GOD" is an acronym which stands "GOD Over Djinn". 

The word "Djinn" is used designate Genies, Meta-Genies, Meta-Meta- 

Gen etc. It is a Typeless word. 
Achilles: But-but-how can "GOD" be a word in own acronym? That doesn't 

make any sense! 

Genie: Oh, aren't you acquainted with recursive acronyms? I thought 
everybody knew about them. \ see, "GOD" stands for "GOD Over 
Djinn"-which can be expanded as "GOD Over Djinn, O, Djinn"-and 
that can, in turn, be expanded to "G( Over Djinn, Over Djinn, Over 
Djinn"-which can its turn, be further expanded ... You can go as as 
you like. 

Achilles: But I'll never finish! 

Genie: Of course not. You can never totally expand GOD. 

Achilles: Hmm ... That's puzzling. What did you me when you said to the 

Meta-Genie, "I have a sped wish to make of you, 0 Djinn, and of 


Genie: I wanted not only to make a request of Meta-Genie, but also of all the 
Djinns over her. 'I recursive acronym method accomplishes this qL 
naturally. You see, when the Meta-Genie received my request, she 
then had to pass it upwards to I GOD. So she forwarded a similar 
message to I Meta-Meta-Genie, who then did likewise to t Meta-Meta- 
Meta-Genie ... Ascending the chain this way transmits the message to 

Little Harmonic Labyrinth 


Achilles: I see. You mean GOD sits up at the top of the ladder of djinns? 

Genie: No, no, no! There is nothing "at the top", for there is no top. That is 
why GOD is a recursive acronym. GOD is not some ultimate djinn; 
GOD is the tower of djinns above any given djinn. 

Tortoise: It seems to me that each and every djinn would have a different 
concept of what GOD is, then, since to any djinn, GOD is the set of 
djinns above him or her, and no two djinns share that set. 

Genie: You're absolutely right-and since I am the lowest djinn of all, my 
notion of GOD is the most exalted one. I pity the higher djinns, who 
fancy themselves somehow closer to GOD. What blasphemy! 

Achilles: By gum, it must have taken genies to invent GOD. 

Tortoise: Do you really believe all this stuff about GOD, Achilles? 

Achilles: Why certainly, I do. Are you atheistic, Mr. T? Or are you agnostic? 

Tortoise: I don't think I'm agnostic. Maybe I'm metaagnostic. 

Achilles: Whaaat? I don't follow you at all. 

Tortoise: Let's see ... If I were meta-agnostic, I'd be confused over whether 
I'm agnostic or not-but I'm not quite sure if I feel THAT way; hence I 
must be meta-meta-agnostic (I guess). Oh, well. Tell me, Genie, does 
any djinn ever make a mistake, and garble up a message moving up or 
down the chain? 

Genie: This does happen; it is the most common cause for Typeless Wishes 
not being granted. You see, the chances are infinitesimal, that a 
garbling will occur at any PARTICULAR link in the chain-but when 
you put an infinite number of them in a row, it becomes virtually 
certain that a garbling will occur SOMEWHERE. In fact, strange as it 
seems, an infinite number of garblings usually occur, although they 
are very sparsely distributed in the chain. 

Achilles: Then it seems a miracle that any Typeless Wish ever gets carried 

Genie: Not really. Most garblings are inconsequential, and many garblings 
tend to cancel each other out. But occasionally-in fact, rather seldom- 
the nonfulfillment of a Typeless Wish can be traced back to a single 
unfortunate djinn's garbling. When this happens, the guilty djinn is 
forced to run an infinite 

Little Harmonic Labyrinth 


Gauntlet and get paddled on his or her rump, by GOD. It's good fun for the 
paddlers, and q harmless for the paddlee. You might be amused by the 

Achilles: I would love to see that! But it only happens when a Typeless Wish 

goes ungranted? 
Genie: That's right. 

Achilles: Hmm ... That gives me an idea for my w Tortoise: Oh, really? What 
is it? Achilles: I wish my wish would not be granted! 

(At that moment, an event-or is "event" the word for it? —takes place which 
cannot be described, and hence no attempt will be made to describe it.) 

Achilles: What on earth does that cryptic comment mean? 
Tortoise: It refers to the Typeless Wish Achilles made. 
Achilles: But he hadn't yet made it. 

Tortoise: Yes, he had. He said, "I wish my wish would not be 
granted", and the Genie took THAT to be his wish. 

(At that moment, some footsteps are heard coming down the hallway in 
their direction.) 

Achilles: Oh, my! That sounds ominous. 

(The footsteps stop; then they turn around and fade away.) 

Tortoise: Whew! 

Achilles: But does the story go on, let's see. or is that the end? Turn the page 
and let's see. 

( The Tortoise turns the page of "Djinn and Tonic ", where they find that the 
story goes on ...) 

Achilles: Hey! What happened? Where is my Genie: lamp? My cup of 
espresso? What happened to young friends from the Convex and 
Concave worlds? What are all those little lizards doing hi 

Tortoise: I'm afraid our context got restored incorrectly Achilles. 

Achilles: What on earth does that cryptic comment mean? 

Tortoise: I refer to the Typeless Wish you made. 

Achilles: But I hadn't yet made it. 

Tortoise: Yes, you had. You said, "I wish my wish would not be 

granted", and the Genie took THAT to be your wish. 
Achilles: Oh, my! That sounds ominous. 
Tortoise; It spells PARADOX. For that Typeless wish to be 

Little Harmonic Labyrinth 


granted, it had to be denied - yet not to grant it would be to grant 

Achilles: So what happened? Did the earth come to a standstill? Did the 

universe cave in? 
Tortoise: No. The System crashed. Achilles: What does that mean? 
Tortoise: It means that you and I, Achilles, were suddenly and 

instantaneously transported to Tumbolia. Achilles: To where? 
Tortoise: Tumbolia: the land of dead hiccups and extinguished light 

bulbs. It's a sort of waiting room, where dormant software waits 

for its host hardware to come back up. No telling how long the 

System was down, and we were in Tumbolia. It could have been 

moments, hours, days-even years. 
Achilles: I don't know what software is, and I don't know what hardware 

is. But I do know that I didn't get to make my wishes! I want my 

Genie back! 

Tortoise: I'm sorry, Achilles-you blew it. You crashed the System, and 
you should thank your lucky stars that we're back at all. Things 
could have come out a lot worse. But I have no idea where we 

Achilles: I recognize it now-we're inside another of Escher's pictures. 

This time it's Reptiles. 
Tortoise: Aha! The System tried to save as much of our context as it 

could before it crashed, and it got as far as recording that it was 

an Escher picture with lizards before it went down. That's 


Achilles: And look-isn't that our phial of poppingtonic over there on the 

table, next to the cycle of lizards? 
Tortoise: It certainly is, Achilles. I must say, we are very lucky indeed. 

The System was very kind to us, in giving us back our popping- 

tonic-it's precious stuff! 
Achilles: I'll say! Now we can pop back out of the Escher world, into my 


Tortoise: There are a couple of books on the desk, next to the tonic. I 
wonder what they are. {He picks up the smaller one, which is 
open to a random page.) This looks like a moderately 
provocative book. 

Achilles: Oh, really? What is its title? 

Tortoise: Provocative Adventures of the Tortoise and Achilles Taking 
Place in Sundry Parts of the Globe. It sounds like an interesting 
book to read out of. 

Little Harmonic Labyrinth 


FIGURE 24. Reptiles, by M. C. Escher (lithograph, 1943). 

Achilles: Well, You can read it if you want, but as for I'm not going to 
take any chances with t popping-tonic-one of the lizards might 
knock it off the table, so I'm going to get it right now! 

(He dashes over to the table and reaches for the popping-tonic, but in 
his haste he somehow bumps the flask of tonic, and it tumbles off the 
desk and begins rolling.) 

Oh, no! Mr. T-look! I accidentally knocked tonic onto the floor, and it's 
rolling toward towards-the stairwell! Quick-before it falls! 

(The Tortoise, however, is completely wrapped up in the thin volume 
which he has in his hands.) Achilles: Well, You can read it if you 
want, but as for I'm not going to take any chances with t popping- 
tonic-one of the lizards might knock it off the table, so I'm going 
to get it right 

Little Harmonic Labyrinth 


Tortoise (muttering): Eh? This story looks fascinating. 
Achilles: Mr. T, Mr. T, help! Help catch the tonic-flask! 
Tortoise: What's all the fuss about? 

Achilles: The tonic-flask-I knocked it down from the desk, and now it's 
rolling and 

(At that instant it reaches the brink of the stairwell, and plummets 
over ... ) 

Oh no! What can we do? Mr. Tortoise-aren't you alarmed? We're 
losing our tonic! It's just fallen down the stairwell! There's only one 
thing to do! We'll have to go down one story! 
Tortoise: Go down one story? My pleasure. Won't you join me? 

(He begins to read aloud, and Achilles, pulled in two directions at 
once, finally stays, taking the role of the Tortoise.) 

Achilles: It's very dark here, Mr. T. I can't see a thing. Oof! I bumped 

into a wall. Watch out! 
Tortoise: Here -I have a couple of walking sticks. Why don't you take one 

of them? You can hold it out in front of you so that you don't 

bang into things. 

Achilles: Good idea. (He takes the stick) Do you get the sense that this 
path is curving gently to the left as we walk? Tortoise: Very 
slightly, yes. 

Achilles: I wonder where we are. And whether we'll ever see the light of 
day again. I wish I'd never listened to you, when you suggested I 
swallow some of that "DRINK ME" stuff. 

Tortoise: I assure you, it's quite harmless. I've done it scads of times, and 
not a once have I ever regretted it. Relax and enjoy being small. 

Achilles: Being small? What is it you've done to me, Mr. T? 

Tortoise: Now don't go blaming me. You did it of your own free will. 
Achilles: Have you made me shrink? So that this labyrinth we're 
in is actually some teeny thing that someone could STEP on? 

Little Harmonic Labyrinth 


FIGURE 25. Cretan Labyrinth (Italian engraving; School of 
Finiguerra). [From N Matthews, Mazes and Labyrinths: Their 
History and Development (New York: Dover Publications, 1970). 

Tortoise: Labyrinth? Labyrinth? Could it Are we in the notorious Little 

Harmonic Labyrinth of the dreaded Majotaur? 
Achilles: Yiikes! What is that? 

Tortoise: They say-although I person never believed it myself-that an I 
Majotaur has created a tiny labyrinth sits in a pit in the middle of 
it, waiting innocent victims to get lost in its fears complexity. 
Then, when they wander and dazed into the center, he laughs and 
laughs at them-so hard, that he laughs them to death! 

Achilles: Oh, no! 

Tortoise: But it's only a myth. Courage, Achilles. 

(And the dauntless pair trudge on.) 

Achilles: Feel these walls. They're like o gated tin sheets, or something. 
But the corrugations have different sizes. 

Little Harmonic Labyrinth 


(To emphasize his point, he sticks out his walking stick against the 
wall surface as he walks. As the stick bounces back and forth against 
the corrugations, strange noises echo up and down the long curved 
corridor they are in.) 

Tortoise (alarmed): What was THAT? 

Achilles: Oh, just me, rubbing my walking stick against the wall. 
Tortoise: Whew! I thought for a moment it was the bellowing of the 

ferocious Majotaur! Achilles: I thought you said it was all a 


Tortoise: Of course it is. Nothing to be afraid of. 

(Achilles puts his walking stick back against the wall, and continues 
walking. As he does so, some musical sounds are heard, coming from 
the point where his stick is scraping the wall.) 

Tortoise: Uh-oh. I have a bad feeling, Achilles. 

That Labyrinth may not be a myth, after all. Achilles: Wait a minute. 
What makes you change your mind all of a sudden? Tortoise: Do 
you hear that music? 

(To hear more clearly, Achilles lowers the stick, and the strains of 
melody cease.) 

Hey! Put that back! I want to hear the end of this piece! 

(Confused, Achilles obeys, and the music resumes.) 

Thank you. Now as I was about to say, I have just figured out where 
we are. 

Achilles: Really? Where are we? 

Tortoise: We are walking down a spiral groove of a record in its jacket. 
Your stick scraping against the strange shapes in the wall acts 
like a needle running down the groove, allowing us to hear the 

Achilles: Oh, no, oh, no ... 

Tortoise: What? Aren't you overjoyed? Have you ever had the chance to 
be in such intimate contact with music before? 

Little Harmonic Labyrinth 


Achzltes: How am I ever going to win footraces against full-sized people 

when I am smaller than a flea, Mr. Tortoise? 
Tortoise: Oh, is that all that's bothering you That's nothing to fret abopt, 


Achilles: The way you talk, I get the impression that you never worry at 

Tortoise: I don't know. But one thing for certain is that I don't worry 
about being small. Especially not when faced with the awful 
danger of the dreaded Majotaur! 

Achilles: Horrors! Are you telling me 

Tortoise: I'm afraid so, Achilles. The music gave it away. 

Achilles: How could it do that? 

Tortoise: Very simple. When I heard melody B-A-C-H in the top voice, 
I immediately realized that the grooves we're walking through 
could only be Little Harmonic Labyrinth, one of Bach's er known 
organ pieces. It is so named cause of its dizzyingly frequent 

Achilles: Wh-what are they? 

Tortoise: Well, you know that most music pieces are written in a key, or 

tonality, as C major, which is the key of this o; 
Achilles: I had heard the term before. Do that mean that C is the note 

you want to on? 

Tortoise: Yes, C acts like a home base, in a Actually, the usual word is 

Achilles: Does one then stray away from tonic with the aim of eventually 

Tortoise: That's right. As the piece develops ambiguous chords and 
melodies are t which lead away from the tonic. Little by little, 
tension builds up-you feel at creasing desire to return home, to 
hear the tonic. 

Achilles: Is that why, at the end of a pie always feel so satisfied, as if I 

had waiting my whole life to hear the ton 
Tortoise: Exactly. The composer has uses knowledge of harmonic 

progressions to 

Little Harmonic Labyrinth 


manipulate your emotions, and to build up hopes in you to hear 
that tonic. 

Achilles: But you were going to tell me about modulations. 

Tortoise: Oh, yes. One very important thing a composer can do is to 
"modulate" partway through a piece, which means that he sets up 
a temporary goal other than resolution into the tonic. 

Achilles: I see ... I think. Do you mean that some sequence of chords 
shifts the harmonic tension somehow so that I actually desire to 
resolve in a new key? 

Tortoise: Right. This makes the situation more complex, for although in 
the short term you want to resolve in the new key, all the while at 
the back of your mind you retain the longing to hit that original 
goal-in this case, C major. And when the subsidiary goal is 
reached, there is 

Achilles {suddenly gesturing enthusiastically): Oh, listen to the gorgeous 
upward-swooping chords which mark the end of this Little 
Harmonic Labyrinth! 

Tortoise: No, Achilles, this isn't the end. It's merely 

Achilles: Sure it is! Wow! What a powerful, strong ending! What a sense 
of relief! That's some resolution! Gee! 

(And sure enough, at that moment the music stops, as they emerge into 
an open area with no walls.) 

You see, it Is over. What did I tell you? Tortoise: Something is very 
wrong. This record 

is a disgrace to the world of music. Achilles: What do you mean? 

Tortoise: It was exactly what I was telling you about. Here Bach had 
modulated from C into G, setting up a secondary goal of hearing 
G. This means that you experience two tensions at once-waiting 
for resolution into G, but also keeping in mind that ultimate 
desire -to resolve triumphantly into C Major. 

Achilles: Why should you have to keep any 

Little Harmonic Labyrinth 


thing in mind when listening to a piece of music? Is music only an 
intellectual exercise? 

Tortoise: No, of course not. Some music is highly intellectual, but most 
music is not. And most of the time your ear or br the 
"calculation" for you, and lets your emotions know what they 
want to hear, don't have to think about it consciously in this 
piece, Bach was playing tricks hoping to lead you astray. And in 
your case Achilles, he succeeded. 

Achilles: Are you telling me that I responded to a resolution in a 
subsidiary key? 

Tortoise: That's right. 

Achilles: It still sounded like an ending to me 

Tortoise: Bach intentionally made it sot way. You just fell into his trap. 
It was deliberately contrived to sound like an ending but if you 
follow the harmonic progression carefully, you will see that it is 
in the wrong key. Apparently not just you but this miserable 
record company fell for the same trick-and they truncated the 
piece early. 

Achilles: What a dirty trick Bach played 

Tortoise: That is his whole game -to m lose your way in his Labyrinth! '1 

Majotaur is in cahoots with Bach, And if you don't watch out, he 

i laugh you to death-and perhaps n with you! 
Achilles: Oh, let us hurry up and get here! Quick! Let's run backwards 

grooves, and escape on the outside record before the Evil 

Majotaur finds us. 

Tortoise: Heavens, no! My sensibility is delicate to handle the bizarre the 

gressions which occur when time versed. 
Achilles: Oh, Mr. T, how will we ever get out of here, if we can't just 

retrace our steps 
Tortoise: That's a very good question. 

(A little desperately, Achilles starts runt about aimlessly in the dark. 
Suddenly t is a slight gasp, and then a "thud".) 

Little Harmonic Labyrinth 


Achilles-are you all right? 

Achilles: Just a bit shaken up but otherwise fine. I fell into some big 

Tortoise: You've fallen into the pit of the Evil Majotaur! Here, I'll come 

help you out. We've got to move fast! 
Achilles: Careful, Mr. T-I don't want You to fall in here, too ... 
Tortoise: Don't fret, Achilles. Everything will be all — 

(Suddenly, there is a slight gasp, and then a "thud".) 

Achilles: Mr. T-you fell in, too! Are you all right? 
Tortoise: Only my pride is hurt-otherwise I'm fine. 
Achilles: Now we're in a pretty pickle, aren't we? 

(Suddenly, a giant, booming laugh is heard, alarmingly close to 

Tortoise: Watch out, Achilles! This is no laughing matter. 
Majotaur: Hee hee hee! Ho ho! Haw haw haw! 
Achilles: I'm starting to feel weak, Mr. T ... 
Tortoise: Try to pay no attention to his laugh, 
Achilles. That's your only hope. 

Achilles: I'll do my best. If only my stomach weren't empty! 

Tortoise: Say, am I smelling things, or is there a bowl of hot buttered 

popcorn around here? Achilles: I smell it, too. Where is it coming 


Tortoise: Over here, I think. Oh! I just ran into a big bowl of the stuff. 

Yes, indeed-it seems to be a bowl of popcorn! 
Achilles: Oh, boy-popcorn! I'm going to munch my head off! 

Tortoise: Let's just hope it isn't pushcorn! Pushcorn and popcorn are 
extraordinarily difficult to tell apart. 

Achilles: What's this about Pushkin? 

Tortoise: I didn't say a thing. You must be hearing things. 

Achilles: Go-golly! I hope not. Well, let's dig in! 

Little Harmonic Labyrinth 


(And the two Jriends begin muncnai popcorn (or pushcorn?)-and t 
once POP! I guess it was popcorn; all.) 

Tortoise: What an amusing story. Did you en 

Achilles: Mildly. Only I wonder whether the' out of that Evil Majotaur's 
pit or r Achilles-he wanted to be full-sized again 

Tortoise: Don't worry-they're out, and he is again. That's what the "POP" 
was all abo 

Achilles: Oh, I couldn't tell. Well, now I REAL: find that bottle of tonic. 
For some reason, burning. And nothing would taste bett drink of 

Tortoise: That stuff is renowned for its thirst powers. Why, in some 
places people very crazy over it. At the turn of the century the 
Schonberg food factory stopped ma] and started making cereal 
instead. You cai the uproar that caused. 

Achilles: I have an inkling. But let's go look fo Hey just a moment. 
Those lizards on the you see anything funny about them? 

Tortoise: Umm ... not particularly. What do you see of such great 

Achilles: Don't you see it? They're emerging flat picture without 
drinking any pop] How are they able to do that? 

Tortoise: Oh, didn't I tell you? You can ge picture by moving 
perpendicularly to it you have no popping-tonic. The little li 
learned to climb UP when they want to ge two-dimensional 
sketchbook world. 

Achilles: Could we do the same thing to get Escher picture we're in? 

Tortoise: Of course! We just need to go UP one story, you want to try it? 

Achilles: Anything to get back to my house! I all these provocative 

Tortoise: Follow me, then, up this way. 

(And they go up one story.) 

Achilles: It's good to be back. But something seems wrong. This isn't my 

house! This is YOUR house, Mr. Tortoise 
Tortoise: Well, so it is-and am I glad for that! I wasn't looking 

Little Harmonic Labyrinth 


forward one whit to the long walk back from your house. I am bushed, 
and doubt if I could have made it. 
Achilles: I don't mind walking home, so I guess it's lucky we ended up 
here, after all. 

Tortoise: I'll say! This certainly is a piece of Good Fortune! 

Little Harmonic Labyrinth 


Recursive Structures 
and Processes 

What Is Recursion? 

WHAT IS RECURSION? It is what was illustrated in the Dialogue Little Harmonic 
Labyrinth: nesting, and variations on nesting. The concept is very general. (Stories inside 
stories, movies inside movies, paintings inside paintings, Russian dolls inside Russian 
dolls (even parenthetical comments in. side parenthetical comments !)-these are just a few 
of the charms of recursion.) However, you should he aware that the meaning of 
"recursive' in this Chapter is only faintly related to its meaning in Chapter 111. The 
relation should be clear by the end of this Chapter. 

Sometimes recursion seems to brush paradox very closely. For example, there are 
recursive definitions. Such a definition may give the casual viewer the impression that 
something is being defined in terms of itself. That would be circular and lead to infinite 
regress, if not to paradox proper. Actually, a recursive definition (when properly 
formulated) never leads to infinite regress or paradox. This is because a recursive 
definition never defines something in terms of itself, but always in terms of simpler 
versions of itself. What I mean by this will become clearer shortly, when ' show some 
examples of recursive definitions. 

One of the most common ways in which recursion appears in daily life is when 
you postpone completing a task in favor of a simpler task, often o the same type. Here is 
a good example. An executive has a fancy telephone and receives many calls on it. He is 
talking to A when B calls. To A he say,, "Would you mind holding for a moment?" Of 
course he doesn't really car if A minds; he just pushes a button, and switches to B. Now C 
calls. The same deferment happens to B. This could go on indefinitely, but let us not get 
too bogged down in our enthusiasm. So let's say the call with C terminates. Then our 
executive "pops" back up to B, and continues. Meanwhile A is sitting at the other end of 
the line, drumming his fingernails again some table, and listening to some horrible 
Muzak piped through the phone lines to placate him ... Now the easiest case is if the call 
with B simply terminates, and the executive returns to A finally. But it could happen that 
after the conversation with B is resumed, a new caller-D-calls. B is once again pushed 
onto the stack of waiting callers, and D is taken care of. Aft D is done, back to B, then 
back to A. This executive is hopelessly mechanical, to be sure-but we are illustrating 
recursion in its most precise form 

Recursive Structures and Processes 


Pushing, Popping, and Stacks 

In the preceding example, I have introduced some basic terminology of recursion-at least 
as seen through the eyes of computer scientists. The terms are push, pop, and stack (or 
push-down stack, to be precise) and they are all related. They were introduced in the late 
1950's as part of IPL, one of the first languages for Artificial Intelligence. You have 
already encountered "push" and "pop" in the Dialogue. But I will spell things out 
anyway. To push means to suspend operations on the task you're currently working on, 
without forgetting where you are-and to take up a new task. The new task is usually said 
to be "on a lower level" than the earlier task. To pop is the reverse-it means to close 
operations on one level, and to resume operations exactly where you left off, one level 

But how do you remember exactly where you were on each different level? The 
answer is, you store the relevant information in a stack. So a stack is just a table telling 
you such things as (1) where you were in each unfinished task (jargon: the "return 
address"), (2) what the relevant facts to know were at the points of interruption (jargon: 
the "variable bindings"). When you pop back up to resume some task, it is the stack 
which restores your context, so you don't feel lost. In the telephone-call example, the 
stack tells you who is waiting on each different level, and where you were in the 
conversation when it was interrupted. 

By the way, the terms "push", "pop", and "stack" all come from the visual image 
of cafeteria trays in a stack. There is usually some sort of spring underneath which tends 
to keep the topmost tray at a constant height, more or less. So when you push a tray onto 
the stack, it sinks a little-and when you remove a tray from the stack, the stack pops up a 

One more example from daily life. When you listen to a news report on the radio, 
oftentimes it happens that they switch you to some foreign correspondent. "We now 
switch you to Sally Swumpley in Peafog, England." Now Sally has got a tape of some 
local reporter interviewing someone, so after giving a bit of background, she plays it. "I'm 
Nigel Cadwallader, here on scene just outside of Peafog, where the great robbery took 
place, and I'm talking with ..." Now you are three levels down. It may turn out that the 
interviewee also plays a tape of some conversation. It is not too uncommon to go down 
three levels in real news reports, and surprisingly enough, we scarcely have any 
awareness of the suspension. It is all kept track of quite easily by our subconscious mind. 
Probably the reason it is so easy is that each level is extremely different in flavor from 
each other level. If they were all similar, we would get confused in no time flat. 

An example of a more complex recursion is, of course, our Dialogue. There, 
Achilles and the Tortoise appeared on all the different levels. Sometimes they were 
reading a story in which they appeared as characters. That is when your mind may get a 
little hazy on what's going on, and you have to concentrate carefully to get things straight. 
"Let's see, the real Achilles and Tortoise are still up there in Goodfortune's helicopter, but 

Recursive Structures and Processes 


secondary ones are in some Escher picture-and then they found this book and are reading 
in it, so it's the tertiary Achilles and Tortoise who wandering around inside the grooves 
of the Little Harmonic Labyrinth, wait a minute-I left out one level somewhere ..." You 
have to ha conscious mental stack like this in order to keep track of the recursion the 
Dialogue. (See Fig. 26.) 


O>od fortune' i 
ikv hideaway 

■V. 1 1 1 1 1 r — htiittr 

I V 

* r 

(7?Bt** and 1 f.V.vd t'f / L * ] 



\ i 

I'artoKr'i home 

' 1 

f\ h 

1 1 


Ltd* Harmonii l-dhyi iMlh 

FIGURE 26. Diagram of the structure of the Dialogue Little Harmonic Labyrinth 
Vertical descents are "pushes"; rises ore "pops". Notice the similarity of this diagram to 
indentation pattern of the Dialogue. From the diagram it is clear that the initial tension 
Goodfortune's thr eat-never was resolved; Achilles and the Tortoise were just left 
dangling the sky. Some readers might agonize over this unpopped push, while others 
might not ba eyelash. In the story, Bach's musical labyrinth likewise was cut off too soon- 
but Achilles d even notice anything funny. Only the Tortoise was aware of the more 
global dangling tension 

Stacks in Music 

While we're talking about the Little Harmonic Labyrinth, we should discuss 
something which is hinted at, if not stated explicitly in the Dialogue: that hear music 
recursively-in particular, that we maintain a mental stack of keys, and that each new 
modulation pushes a new key onto the stack, implication is further that we want to hear 
that sequence of keys retrace reverse order-popping the pushed keys off the stack, one by 
one, until the tonic is reached. This is an exaggeration. There is a grain of truth to it 

Any reasonably musical person automatically maintains a shallow with two keys. 
In that "short stack", the true tonic key is held and also most immediate "pseudotonic" 
(the key the composer is pretending t in). In other words, the most global key and the 
most local key. That the listener knows when the true tonic is regained, and feels a strong 
s of "relief. The listener can also distinguish (unlike Achilles) between a local easing of 
tension-for example a resolution into the pseudotonic — 

Recursive Structures and Processes 


and a global resolution. In fact, a pseudoresolution should heighten the global tension, 
not relieve it, because it is a piece of irony-just like Achilles' rescue from his perilous 
perch on the swinging lamp, when all the while you know he and the Tortoise are really 
awaiting their dire fates at the knife of Monsieur Goodfortune. 

Since tension and resolution are the heart and soul of music, there are many, many 
examples. But let us just look at a couple in Bach. Bach wrote many pieces in an 
"AABB" form-that is, where there are two halves, and each one is repeated. Let's take the 
gigue from the French Suite no. 5, which is quite typical of the form. Its tonic key is G, 
and we hear a gay dancing melody which establishes the key of G strongly. Soon, 
however, a modulation in the A-section leads to the closely related key of D (the 
dominant). When the A-section ends, we are in the key of D. In fact, it sounds as if the 
piece has ended in the key of D! (Or at least it might sound that way to Achilles.) But 
then a strange thing happens-we abruptly jump back to the beginning, back to G, and 
rehear the same transition into D. But then a strange thing happens-we abruptly jump 
back to the beginning, back to G, and rehear the same transition into D. 

Then comes the B-section. With the inversion of the theme for our melody, we 
begin in D as if that had always been the tonic-but we modulate back to G after all, which 
means that we pop back into the tonic, and the B-section ends properly. Then that funny 
repetition takes place, jerking us without warning back into D, and letting us return to G 
once more. Then that funny repetition takes place, jerking us without warning 

back into D, and letting us return to G once more. 

The psychological effect of all this key shifting-some jerky, some smooth- is very 
difficult to describe. It is part of the magic of music that we can automatically make sense 
of these shifts. Or perhaps it is the magic of Bach that he can write pieces with this kind 
of structure which have such a natural grace to them that we are not aware of exactly 
what is happening. 

The original Little Harmonic Labyrinth is a piece by Bach in which he tries to 
lose you in a labyrinth of quick key changes. Pretty soon you are so disoriented that you 
don't have any sense of direction left-you don't know where the true tonic is, unless you 
have perfect pitch, or like Theseus, have a friend like Ariadne who gives you a thread that 
allows you to retrace your steps. In this case, the thread would be a written score. This 
piece-another example is the Endlessly Rising Canon-goes to show that, as music 
listeners, we don't have very reliable deep stacks. 

Recursion in Language 

Our mental stacking power is perhaps slightly stronger in language. The grammatical 
structure of all languages involves setting up quite elaborate push-down stacks, though, to 
be sure, the difficulty of understanding a sentence increases sharply with the number of 
pushes onto the stack. The proverbial German phenomenon of the "verb-at-the-end", 
about which 

Recursive Structures and Processes 


Droll tales of absentminded professors who would begin a sentence, ramble on for 
an entire lecture, and then finish up by rattling off a string of verbs by which their 
audience, for whom the stack had long since lost its coherence, would be totally 
nonplussed, are told, is an excellent example of linguistic pushing and popping. The 
confusion among the audience out-of-order popping from the stack onto which the 
professor's verbs been pushed, is amusing to imagine, could engender. But in normal ken 
German, such deep stacks almost never occur-in fact, native speaker of German often 
unconsciously violate certain conventions which force verb to go to the end, in order to 
avoid the mental effort of keeping track of the stack. Every language has constructions 
which involve stacks, though usually of a less spectacular nature than German. But there 
are always of rephrasing sentences so that the depth of stacking is minimal. 

Recursive Transition Networks 

The syntactical structure of sentences affords a good place to present a of describing 
recursive structures and processes: the Recursive Transition Network (RTN). An RTN is 
a diagram showing various paths which can be followed to accomplish a particular task. 
Each path consists of a number of nodes, or little boxes with words in them, joined by 
arcs, or lines with arrows. The overall name for the RTN is written separately at the left, 
and the and last nodes have the words begin and end in them. All the other nodes contain 
either very short explicit directions to perform, or else name other RTN's. Each time you 
hit a node, you are to carry out the direct inside it, or to jump to the RTN named inside it, 
and carry it out. 

Let's take a sample RTN, called ORNATE NOUN, which tells how to construct 
a certain type of English noun phrase. (See Fig. 27a.) If traverse ORNATE NOUN 
purely horizontally, we begin', then we create ARTICLE, an ADJECTIVE, and a 
NOUN, then we end. For instance, "the shampoo" or "a thankless brunch". But the arcs 
show other possibilities such as skipping the article, or repeating the adjective. Thus we 
co construct "milk", or "big red blue green sneezes", etc. 

When you hit the node NOUN, you are asking the unknown black I called NOUN 
to fetch any noun for you from its storehouse of nouns. This is known as a procedure 
call, in computer science terminology. It means you temporarily give control to a 
procedure (here, NOUN) which (1) does thing (produces a noun) and then (2) hands 
control back to you. In above RTN, there are calls on three such procedures: ARTICLE, 
ADJECTIVE and NOUN. Now the RTN ORNATE NOUN could itself be called from 
so other RTN-for instance an RTN called SENTENCE. In this case, ORNATE NOUN 
would produce a phrase such as "the silly shampoo" and d return to the place inside 
SENTENCE from which it had been called. I quite reminiscent of the way in which you 
resume where you left off nested telephone calls or nested news reports. 

However, despite calling this a "recursive transition network", we have 

Recursive Structures and Processes 



* ' 









** A 





FIGURE 27. Recursive Transition Networks for ORNATE NOUN and FANCY NOUN. 

not exhibited any true recursion so far. Things get recursive-and seemingly circular-when 
you go to an RTN such as the one in Figure 27b, for FANCY NOUN. As you can see, 
every possible pathway in FANCY NOUN involves a call on ORNATE NOUN, so there 
is no way to avoid getting a noun of some sort or other. And it is possible to be no more 
ornate than that, coming out merely with "milk" or "big red blue green sneezes". But 
three of the pathways involve recursive calls on FANCY NOUN itself. It certainly looks 
as if something is being defined in terms of itself. Is that what is happening, or not? 

The answer is "yes, but benignly". Suppose that, in the procedure SENTENCE, 
there is a node which calls FANCY NOUN, and we hit that node. This means that we 
commit to memory (viz., the stack) the location of that node inside SENTENCE, so we'll 
know where to return to-then we transfer our attention to the procedure FANCY NOUN. 
Now we must choose a pathway to take, in order to generate a FANCY NOUN. Suppose 
we choose the lower of the upper pathways-the one whose calling sequence goes: 


Recursive Structures and Processes 


So we spit out an ORNATE NOUN: "the strange bagels"; a RELATIVE NOUN: 
"that"; and now we are suddenly asked for a FANCY NOUN. B are in the middle of 
FANCY NOUN! Yes, but remember our executive was in the middle of one phone call 
when he got another one. He n stored the old phone call's status on a stack, and began the 
new one nothing were unusual. So we shall do the same. 

We first write down in our stack the node we are at in the outer call on FANCY 
NOUN, so that we have a "return address"; then we jump t beginning of FANCY NOUN 
as if nothing were unusual. Now we h~ choose a pathway again. For variety's sake, let's 
choose the lower pat] ORNATE NOUN; PREPOSITION; FANCY NOUN. That 
means we produce an ORNATE NOUN (say "the purple cow"), then a PREPOSITION 
(say "without"), and once again, we hit the recursion. So we hang onto our hats descend 
one more level. To avoid complexity, let's assume that this the pathway we take is the 
direct one just ORNATE NOUN. For example: we might get "horns". We hit the node 
END in this call on FANCY NOUN which amounts to popping out, and so we go to our 
stack to find the return address. It tells us that we were in the middle of executing 
FANCY NOUN one level up-and so we resume there. This yields "the purple cow 
without horns". On this level, too, we hit END, and so we pop up once more, this finding 
ourselves in need of a VERB-so let's choose "gobbled". This ends highest-level call on 
FANCY NOUN, with the result that the phrase 

"the strange bagels that the purple cow without horns gobbled" 

will get passed upwards to the patient SENTENCE, as we pop for the last time. 

As you see, we didn't get into any infinite regress. The reason is tl least one 
pathway inside the RTN FANCY NOUN does not involve recursive calls on FANCY 
NOUN itself. Of course, we could have perversely insisted on always choosing the 
bottom pathway inside FANCY NOUN then we would never have gotten finished, just 
as the acronym "GOD" never got fully expanded. But if the pathways are chosen at 
random, an infinite regress of that sort will not happen. 

"Bottoming Out" and Heterarchies 

This is the crucial fact which distinguishes recursive definitions from circular 
ones. There is always some part of the definition which avoids reference, so that the 
action of constructing an object which satisfies the definition will eventually "bottom 

Now there are more oblique ways of achieving recursivity in RTNs than by self- 
calling. There is the analogue of Escher's Drawing (Fig. 135), where each of two 
procedures calls the other, but not itself. For example, we could have an RTN named 
CLAUSE, which calls FANCY NOUN whenever it needs an object for a transitive verb, 
and conversely, the u path of FANCY NOUN could call RELATIVE PRONOUN and 
then CLAUSE 

Recursive Structures and Processes 


whenever it wants a relative clause. This is an example of indirect recursion. It is 
reminiscent also of the two-step version of the Epimenides paradox. 

Needless to say, there can be a trio of procedures which call one another, 
cyclically-and so on. There can be a whole family of RTN's which are all tangled up, 
calling each other and themselves like crazy. A program which has such a structure in 
which there is no single "highest level", or "monitor", is called a heterarchy (as 
distinguished from a hierarchy). The term is due, I believe, to Warren McCulloch, one of 
the first cyberneticists, and a reverent student of brains and minds. 

Expanding Nodes 

One graphic way of thinking about RTN's is this. Whenever you are moving along some 
pathway and you hit a node which calls on an RTN, you "expand" that node, which 
means to replace it by a very small copy of the RTN it calls (see Fig. 28). Then you 
proceed into the very small RTN, 

FIGURE 28. The FANCY NOUN RTN with one node recursively expanded 

When you pop out of it, you are automatically in the right place in the big one. While in 
the small one, you may wind up constructing even more miniature RTN's. But by 
expanding nodes only when you come across them, you avoid the need to make an 
infinite diagram, even when an RTN calls itself. 

Expanding a node is a little like replacing a letter in an acronym by the word it 
stands for. The "GOD" acronym is recursive but has the defect-or advantage-that you 
must repeatedly expand the "G'; thus it never bottoms out. When an RTN is implemented 
as a real computer program, however, it always has at least one pathway which avoids 
recursivity (direct or indirect) so that infinite regress is not created. Even the most 
heterarchical program structure bottoms out-otherwise it couldn't run! It would just be 
constantly expanding node after node, but never performing any action. 

Recursive Structures and Processes 


Diagram G and Recursive Sequences 

Infinite geometrical structures can be defined in just this way-that is by expanding 
node after node. For example, let us define an infinite diagram called "Diagram G". To 
do so, we shall use an implicit representation. In two nodes, we shall write merely the 
letter G', which, however, will stand for an entire copy of Diagram G. In Figure 29a, 
Diagram G is portrayed implicitly. Now if we wish to see Diagram G more explicitly, we 
expand each of the two Gs-that is, we replace them by the same diagram, only reduced 
in scale (see Fig. 29b). This "second-order" version of Diagram gives us an inkling of 
what the final, impossible-to-realize Diagram G really looks like. In Figure 30 is shown a 
larger portion of Diagram G, where all the nodes have been numbered from the bottom 
up, and from left to right. Two extra nodes-numbers — 1 and 2— have been inserted at 
the bottom 

This infinite tree has some very curious mathematical properties Running up its 
right-hand edge is the famous sequence of Fibonacci numbers. 

1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 

discovered around the year 1202 by Leonardo of Pisa, son of Bonaccio, ergo "Filius 
Bonacci", or "Fibonacci" for short. These numbers are best 

FIGURE 29. (a) Diagram G, unexpanded. (c) Diagram H, unexpanded 

(b) Diagram G, expanded once. (d) Diagram H, expanded once 


<b) (d) 

Recursive Structures and Processes 


FIGURE 30. Diagram G, further expanded and with numbered nodes. 

defined recursively by the pair of formulas 

FIBO(n) = FIBO(n- 1) + FIBO(n-2) for n > 2 

FIBO(l) = FIBO(2) = 1 

Notice how new Fibonacci numbers are defined in terms of previous Fibonacci numbers. 
We could represent this pair of formulas in an RTN (see Fig. 31). 

let y - FIBOIn-2) 

X + J 

[if H = I or 2] 

FIGURE 31. An RTN for Fibonacci numbers. 

Thus you can calculate FIBO(15) by a sequence of recursive calls on the procedure 
defined by the RTN above. This recursive definition bottoms out when you hit FIBO(l) 
or FIBO(2) (which are given explicitly) after you have worked your way backwards 
through descending values of n. It is slightly awkward to work your way backwards, 
when you could just as well work your way forwards, starting with FIBO(l) and FIBO(2) 
and always adding the most recent two values, until you reach FIBO(15). That way you 
don't need to keep track of a stack. 

Now Diagram G has some even more surprising properties than this. Its entire 
structure can be coded up in a single recursive definition, as follows: 

Recursive Structures and Processes 


G(n) = n - G(G(n- l))forn>0 
G(0) = 0 

How does this function G(n) code for the tree-structure? Quite simply you construct a 
tree by placing G(n) below n, for all values of n, you recreate Diagram G. In fact, that is 
how I discovered Diagram G in the place. I was investigating the function G, and in 
trying to calculate its values quickly, I conceived of displaying the values I already knew 
in a tree. T surprise, the tree turned out to have this extremely orderly recursive 
geometrical description. 

What is more wonderful is that if you make the analogous tree function H(n) 
defined with one more nesting than G — 

H(n) = n - H(H(H(n - 1 ))) for n > 0 

H(0) = 0 

—then the associated "Diagram H" is defined implicitly as shown in Figure 29c. The 
right-hand trunk contains one more node; that is the difference. The first recursive 
expansion of Diagram H is shown in Figure 29d. And so it goes, for any degree of 
nesting. There is a beautiful regularity to the recursive geometrical structures, which 
corresponds precisely to the recursive algebraic definitions. 

A problem for curious readers is: suppose you flip Diagram G around as if in a 
mirror, and label the nodes of the new tree so they increase left to right. Can you find a 
recursive algebraic definition for this "flip-tree. What about for the "flip" of the H-tree? 

Another pleasing problem involves a pair of recursively intertwined functions 
F(n) and M(n) — "married" functions, you might say — defined this way: 

F(n) = n - M(F(n- 1)) 

For n > 0 

M(n) = n - F(M(n- 1)) 
F(0)= l,andM(0) = 0 

The RTN's for these two functions call each other and themselves as well. The 
problem is simply to discover the recursive structures of Diagram F; and Diagram M. 
They are quite elegant and simple. 

A Chaotic Sequence 

One last example of recursion in number theory leads to a small my Consider the 
following recursive definition of a function: 

Q(n) = Q(n - Q(n- 1)) + Q(n - Q(n-2)) for n > 2 
Q(1) = Q(2)=1. 

Recursive Structures and Processes 


It is reminiscent of the Fibonacci definition in that each new value is a sum of two 
previous values-but not of the immediately previous two values. Instead, the two 
immediately previous values tell how far to count back to obtain the numbers to be added 
to make the new value! The first 17 Q-numbers run as follows: 

1, 1, 2, 3, 3, 4, 5, 5, 6, 6, 6, 8, 8, 8, 10, 9, 10, ... . 

5 + 6 = 11 how far to move to the left 

New term 

To obtain the next one, move leftwards (from the three dots) respectively 10 and 9 terms; 
you will hit a 5 and a 6, shown by the arrows. Their sum-1 1-yields the new value: Q(18). 
This is the strange process by which the list of known Q-numbers is used to extend itself. 
The resulting sequence is, to put it mildly, erratic. The further out you go, the less sense it 
seems to make. This is one of those very peculiar cases where what seems to be a 
somewhat natural definition leads to extremely puzzling behavior: chaos produced in a 
very orderly manner. One is naturally led to wonder whether the apparent chaos conceals 
some subtle regularity. Of course, by definition, there is regularity, but what is of interest 
is whether there is another way of characterizing this sequence-and with luck, a 
nonrecursive way. 

Two Striking Recursive Graphs 

The marvels of recursion in mathematics are innumerable, and it is not my purpose to 
present them all. However, there are a couple of particularly striking examples from my 
own experience which I feel are worth presenting. They are both graphs. One came up in 
the course of some number-theoretical investigations. The other came up in the course of 
my Ph.D. thesis work, in solid state physics. What is truly fascinating is that the graphs 
are closely related. 

The first one (Fig. 32) is a graph of a function which I call INT(x). It is plotted 
here for x between 0 and 1 . For x between any other pair of integers n and n + 1 , you just 
find INT(x-n), then add n back. The structure of the plot is quite jumpy, as you can see. It 
consists of an infinite number of curved pieces, which get smaller and smaller towards 
the corners-and incidentally, less and less curved. Now if you look closely at each such 
piece, you will find that it is actually a copy of the full graph, merely curved! The 
implications are wild. One of them is that the graph of INT consists of nothing but copies 
of itself, nested down infinitely deeply. If you pick up any piece of the graph, no matter 
how small, you are holding a complete copy of the whole graph-in fact, infinitely many 
copies of it! 

The fact that INT consists of nothing but copies of itself might make you think it is too 
ephemeral to exist. Its definition sounds too circular. 

Recursive Structures and Processes 







FIGURE 32. Graph of the function INT(x). There is a jump discontinuity at every rat 
value of x. 

How does it ever get off the ground? That is a very interesting matter, main thing to 
notice is that, to describe INT to someone who hasn't see it will not suffice merely to say, 
"It consists of copies of itself" The o half of the story-the nonrecursive half-tells where 
those copies lie in the square, and how they have been deformed, relative to the full 
graph. Only the combination of these two aspects of INT will specify structure of INT. It 
is exactly as in the definition of Fibonacci number where you need two lines-one to 
define the recursion, the other to de the bottom (i.e., the values at the beginning). To be 
very concrete, if make one of the bottom values 3 instead of 1, you will produce a 
completely different sequence, known as the Lucas sequence: 

1, 3, 4, 7, 11, 18, 29, 47, 76, 123,... 
the "bottom" 29 + 47 = 76 

same recursive rule 

as for the Fibonacci numbers 

Recursive Structures and Processes 


What corresponds to the bottom in the definition of INT is a picture (Fig. 33a) 
composed of many boxes, showing where the copies go, and how they are distorted. I call 
it the "skeleton" of INT. To construct INT from its skeleton, you do the following. First, 
for each box of the skeleton, you do two operations: (1) put a small curved copy of the 
skeleton inside the box, using the curved line inside it as a guide; (2) erase the containing 
box and its curved line. Once this has been done for each box of the original skeleton, 
you are left with many "baby" skeletons in place of one big one. Next you repeat the 
process one level down, with all the baby skeletons. Then again, again, and again ... What 
you approach in the limit is an exact graph of INT, though you never get there. By 
nesting the skeleton inside itself over and over again, you gradually construct the graph 
of INT "from out of nothing". But in fact the "nothing" was not nothing-it was a picture. 

To see this even more dramatically, imagine keeping the recursive part of the 
definition of INT, but changing the initial picture, the skeleton. A variant skeleton is 
shown in Figure 33b, again with boxes which get smaller and smaller as they trail off to 
the four corners. If you nest this second skeleton inside itself over and over again, you 
will create the key graph from my Ph.D. thesis, which I call Gplot (Fig. 34). (In fact, 
some complicated distortion of each copy is needed as well-but nesting is the basic idea.). 

Gplot is thus a member of the INT-family. It is a distant relative, because its 
skeleton is quite different from-and considerably more complex than-that of INT. 
However, the recursive part of the definition is identical, and therein lies the family tie. 
I should not keep you too much in the dark about the origin of these beautiful graphs. 
INT-standing for "interchange"-comes from a problem involving "Eta-sequences", which 
are related to continued fractions. The basic idea behind INT is that plus and minus signs 
are interchanged in a certain kind of continued fraction. As a consequence, INT(INT(x)) 
= x. INT has the property that if x is rational, so is INT(x); if x is quadratic, so is INT(x). 
I do not know if this trend holds for higher algebraic degrees. Another lovely feature of 
INT is that at all rational values of x, it has a jump discontinuity, but at all irrational 
values of x, it is continuous. 

Gplot comes from a highly idealized version of the question, "What are the 
allowed energies of electrons in a crystal in a magnetic field?" This problem is interesting 
because it is a cross between two very simple and fundamental physical situations: an 
electron in a perfect crystal, and an electron in a homogeneous magnetic field. These two 
simpler problems are both well understood, and their characteristic solutions seem almost 
incompatible with each other. Therefore, it is of quite some interest to see how nature 
manages to reconcile the two. As it happens, the crystal without-magnetic-field situation 
and the magnetic-field-without-crystal situation do have one feature in common: in each 
of them, the electron behaves periodically in time. It turns out that when the two 
situations are combined, the ratio of their two time periods is the key parameter. In fact, 
that ratio holds all the information about the distribution of allowed electron energies-but 
it only gives up its secret upon being expanded into a continued fraction. 

Recursive Structures and Processes 


Recursive Structures and Processes 


Gplot shows that distribution. The horizontal axis represents energy, and the 
vertical axis represents the above-mentioned ratio of time periods, which we can call "a". 
At the bottom, a is zero, and at the top a is unity. When a is zero, there is no magnetic 
field. Each of the line segments making up Gplot is an "energy band"-that is, it represents 
allowed values of energy. The empty swaths traversing Gplot on all different size scales 
are therefore regions of forbidden energy. One of the most startling properties of Gplot is 
that when a is rational (say p/q in lowest terms), there are exactly q such bands (though 
when q is even, two of them "kiss" in the middle). And when a is irrational, the bands 
shrink to points, of which there are infinitely many, very sparsely distributed in a so- 
called "Cantor set" — another recursively defined entity which springs up in topology. 

You might well wonder whether such an intricate structure would ever show up in 
an experiment. Frankly, I would be the most surprised person in the world if Gplot came 
out of any experiment. The physicality of Gplot lies in the fact that it points the way to 
the proper mathematical treatment of less idealized problems of this sort. In other words, 
Gplot is purely a contribution to theoretical physics, not a hint to experimentalists as to 
what to expect to see! An agnostic friend of mine once was so struck by Gplot's infinitely 
many infinities that he called it "a picture of God", which I don't think is blasphemous at 

Recursion at the Lowest Level of Matter 

We have seen recursion in the grammars of languages, we have seen recursive 
geometrical trees which grow upwards forever, and we have seen one way in which 
recursion enters the theory of solid state physics. Now we are going to see yet another 
way in which the whole world is built out of recursion. This has to do with the structure 
of elementary particles: electrons, protons, neutrons, and the tiny quanta of 
electromagnetic radiation called "photons". We are going to see that particles are-in a 
certain sense which can only be defined rigorously in relativistic quantum mechanics — 
nested inside each other in a way which can be described recursively, perhaps even by 
some sort of "grammar". 

We begin with the observation that if particles didn't interact with each other, 
things would be incredibly simple. Physicists would like such a world because then they 
could calculate the behavior of all particles easily (if physicists in such a world existed, 
which is a doubtful proposition). Particles without interactions are called bare particles, 
and they are purely hypothetical creations; they don't exist. 

Now when you "turn on" the interactions, then particles get tangled up together in 
the way that functions F and M are tangled together, or married people are tangled 
together. These real particles are said to be renormalized-an ugly but intriguing term. 
What happens is that no particle can even be defined without referring to all other 
particles, whose definitions in turn depend on the first particles, etc. Round and round, in 
a never-ending loop. 

Recursive Structures and Processes 


Figure 34. Gplot; a recursive graph, showing energy bands for electrons in an idealized 
crystal in a magnetic field, a representing magnetic field strength, runs vertically from 0 
to 1. Energy runs horizontally. The horizontal line segments are bands of allowed 
electron energies. 

Recursive Structures and Processes 


Let us be a little more concrete, now. Let's limit ourselves to only two kinds of 
particles: electrons and photons. We'll also have to throw in the electron's antiparticle, the 
positron. (Photons are their own antiparticles.) Imagine first a dull world where a bare 
electron wishes to propagate from point A to point B, as Zeno did in my Three-Part 
Invention. A physicist would draw a picture like this: 

There is a mathematical expression which corresponds to this line and its endpoints, and 
it is easy to write down. With it, a physicist can understand the behavior of the bare 
electron in this trajectory. 

Now let us "turn on" the electromagnetic interaction, whereby electrons and 
photons interact. Although there are no photons in the scene, there will nevertheless be 
profound consequences even for this simple trajectory. In particular, our electron now 
becomes capable of emitting and then reabsorbing virtual photons-photons which flicker 
in and out of existence before they can be seen. Let us show one such process: 

Now as our electron propagates, it may emit and reabsorb one photon after another, or it 
may even nest them, as shown below: 

The mathematical expressions corresponding to these diagrams-called "Feynman 
diagrams"-are easy to write down, but they are harder to calculate than that for the bare 
electron. But what really complicates matters is that a photon (real or virtual) can decay 
for a brief moment into an electron-positron pair. Then these two annihilate each other, 
and, as if by magic, the original photon reappears. This sort of process is shown below: 

The electron has a right-pointing arrow, while the positron's arrow points leftwards. 

A •■ 

4 B 

Recursive Structures and Processes 


As you might have anticipated, these virtual processes can be inside each other to 
arbitrary depth. This can give rise to some complicated-looking drawings, such as the one 
in Figure 35. In that man diagram, a single electron enters on the left at A, does some an 
acrobatics, and then a single electron emerges on the right at B. outsider who can't see the 
inner mess, it looks as if one electron peacefully sailed from A to B. In the diagram, you 
can see how el lines can get arbitrarily embellished, and so can the photon lines diagram 
would be ferociously hard to calculate. 

FIGURE 35. A Feynman diagram showing the propagation of a renormalized electron 
from A to B. In this diagram, time increases to the right. Therefore, in the segments 
where the electron 's arrow points leftwards, it is moving "backwards in time ". A more 
intuitive way to say this is that an antielectron (positron) is moving forwards in time. 
Photons are their own antiparticles ; hence their lines have no need of arrows. 

There is a sort of "grammar" to these diagrams, that only certain pictures to be 
realized in nature. For instance, the one be impossible: 

You might say it is not a "well-formed" Feynman diagram. The gram a result of basic 
laws of physics, such as conservation of energy, conservation of electric charge, and so 
on. And, like the grammars of 1 - languages, this grammar has a recursive structure, in 
that it allow' nestings of structures inside each other. It would be possible to drat set of 
recursive transition networks defining the "grammar" of the electromagnetic interaction. 

When bare electrons and bare photons are allowed to interact ii arbitrarily tangled 
ways, the result is renormalized electrons and ph Thus, to understand how a real, physical 
electron propagates from A to B, 

Recursive Structures and Processes 153 

A •- 

the physicist has to be able to take a sort of average of all the infinitely many different 
possible drawings which involve virtual particles. This is Zeno with a vengeance! 

Thus the point is that a physical particle-a renormalized particle involves (1) a 
bare particle and (2) a huge tangle of virtual particles, inextricably wound together in a 
recursive mess. Every real particle's existence therefore involves the existence of 
infinitely many other particles, contained in a virtual "cloud" which surrounds it as it 
propagates. And each of the virtual particles in the cloud, of course, also drags along its 
own virtual cloud, and so on ad infinitum. 

Particle physicists have found that this complexity is too much to handle, and in 
order to understand the behavior of electrons and photons, they use approximations 
which neglect all but fairly simple Feynman diagrams. Fortunately, the more complex a 
diagram, the less important its contribution. There is no known way of summing up all of 
the infinitely many possible diagrams, to get an expression for the behavior of a fully 
renormalized, physical electron. But by considering roughly the simplest hundred 
diagrams for certain processes, physicists have been able to predict one value (the so- 
called g-factor of the muon) to nine decimal places -- correctly! 

Renormalization takes place not only among electrons and photons. Whenever 
any types of particle interact together, physicists use the ideas of renormalization to 
understand the phenomena. Thus protons and neutrons, neutrinos, pi-mesons, quarks-all 
the beasts in the subnuclear zoo they all have bare and renormalized versions in physical 
theories. And from billions of these bubbles within bubbles are all the beasts and baubles 
of the world composed. 

Copies and Sameness 

Let us now consider Gplot once again. You will remember that in the 
Introduction, we spoke of different varieties of canons. Each type of canon exploited 
some manner of taking an original theme and copying it by an isomorphism, or 
information-preserving transformation. Sometimes the copies were upside down, 
sometimes backwards, sometimes shrunken or expanded ... In Gplot we have all those 
types of transformation, and more. The mappings between the full Gplot and the "copies" 
of itself inside itself involve size changes, skewings, reflections, and more. And yet there 
remains a sort of skeletal identity, which the eye can pick up with a bit of effort, 
particularly after it has practiced with INT. 

Escher took the idea of an object's parts being copies of the object itself and made 
it into a print: his woodcut Fishes and Scales (Fig. 36). Of course these fishes and scales 
are the same only when seen on a sufficiently abstract plane. Now everyone knows that a 
fish's scales aren't really small copies of the fish; and a fish's cells aren't small copies of 
the fish; however, a fish's DNA, sitting inside each and every one of the fish's cells, is a 
very convo- 

Recursive Structures and Processes 


FIGURE 36. Fish and Scales, by M. C. Escher (woodcut, 1959). 

luted "copy" of the entire fish- and so there is more than a grain of truth to the Escher 

What is there that is the "same" about all butterflies? The mapping from one 
butterfly to another does not map cell onto cell; rather, it m; functional part onto 
functional part, and this may be partially on a macroscopic scale, partially on a 
microscopic scale. The exact proportions of pa are not preserved; just the functional 
relationships between parts. This is the type of isomorphism which links all butterflies in 
Escher's wood engraving Butterflies (Fig. 37) to each other. The same goes for the more 
abstract butterflies of Gplot, which are all linked to each other by mathematical mappings 
that carry functional part onto functional part, but totally ignore exact line proportions, 
angles, and so on. 

Taking this exploration of sameness to a yet higher plane of abstraction, we might 
well ask, "What is there that is the 'same' about all Esc 1 drawings?" It would be quite 
ludicrous to attempt to map them piece by piece onto each other. The amazing thing is 
that even a tiny section of an 

Recursive Structures and Processes 


FIGURE 37. Butterflies, by M. C. Escher (wood-engraving, 1950). 

Escher drawing or a Bach piece gives it away. Just as a fish's DNA is contained inside 
every tiny bit of the fish, so a creator's "signature" is contained inside every tiny section 
of his creations. We don't know what to call it but "style" — a vague and elusive word. 
We keep on running up against "sameness-in-differentness", and the question 

When are two things the same? 

It will recur over and over again in this book. We shall come at it from all sorts of skew 
angles, and in the end, we shall see how deeply this simple question is connected with the 
nature of intelligence. 

That this issue arose in the Chapter on recursion is no accident, for recursion is a 
domain where "sameness-in-differentness" plays a central role. Recursion is based on the 
"same" thing happening on several differ- 

Recursive Structures and Processes 


ent levels at once. But the events on different levels aren't exactly same-rather, we find 
some invariant feature in them, despite many s in which they differ. For example, in the 
Little Harmonic Labyrinth, all stories on different levels are quite unrelated-their 
"sameness" reside only two facts: (1) they are stories, and (2) they involve the Tortoise 
and Achilles. Other than that, they are radically different from each other. 

Programming and Recursion: Modularity, Loops, Procedures 

One of the essential skills in computer programming is to perceive wl two processes are 
the same in this extended sense, for that leads modularization-the breaking-up of a task 
into natural subtasks. For stance, one might want a sequence of many similar operations 
to be cart out one after another. Instead of writing them all out, one can write a h which 
tells the computer to perform a fixed set of operations and then loop back and perform 
them again, over and over, until some condition is satisfied. Now the body of the loop-the 
fixed set of instructions to repeated-need not actually be completely fixed. It may vary in 
so predictable way. 

An example is the most simple-minded test for the primality o natural number N, 
in which you begin by trying to divide N by 2, then 3, 4, 5, etc. until N - 1. If N has 
survived all these tests without be divisible, it's prime. Notice that each step in the loop is 
similar to, but i the same as, each other step. Notice also that the number of steps varies 
with N-hence a loop of fixed length could never work as a general test primality. There 
are two criteria for "aborting" the loop: (1) if so number divides N exactly, quit with 
answer "NO"; (2) if N - 1 is react as a test divisor and N survives, quit with answer 

The general idea of loops, then, is this: perform some series of related steps over 
and over, and abort the process when specific conditions are n Now sometimes, the 
maximum number of steps in a loop will be known advance; other times, you just begin, 
and wait until it is aborted. The second type of loop — which I call a free loop — is 
dangerous, because criterion for abortion may never occur, leaving the computer in a so- 
cal "infinite loop". This distinction between bounded loops and free loops is one the most 
important concepts in all of computer science, and we shall dev an entire Chapter to it: 
"BlooP and FlooP and GlooP". 

Now loops may be nested inside each other. For instance, suppose t we wish to 
test all the numbers between 1 and 5000 for primality. We c write a second loop which 
uses the above-described test over and over starting with N = I and finishing with N = 
5000. So our program i have a "loop-the-loop" structure. Such program structures are 
typical - in fact they are deemed to be good programming style. This kind of nest loop 
also occurs in assembly instructions for commonplace items, and such activities as 
knitting or crocheting-in which very small loops are 

Recursive Structures and Processes 


repeated several times in larger loops, which in turn are carried out repeatedly ... While 
the result of a low-level loop might be no more than couple of stitches, the result of a 
high-level loop might be a substantial portion of a piece of clothing. 

In music, too, nested loops often occur-as, for instance, when a scale (a small 
loop) is played several times in a row, perhaps displaced in pitch each new time. For 
example, the last movements of both the Prokofiev fifth piano concerto and the 
Rachmaninoff second symphony contain extended passages in which fast, medium, and 
slow scale-loops are played simultaneously by different groups of instruments, to great 
effect. The Prokofiev scales go up; the Rachmaninoff-scales, down. Take your pick. 

A more general notion than loop is that of subroutine, or procedure, which we 
have already discussed somewhat. The basic idea here is that a group of operations are 
lumped together and considered a single unit with a name-such as the procedure 
ORNATE NOUN. As we saw in RTN's, procedures can call each other by name, and 
thereby express very concisely sequences of operations which are to be carried out. This 
is the essence of modularity in programming. Modularity exists, of course, in hi-fi 
systems, furniture, living cells, human society-wherever there is hierarchical 

More often than not, one wants a procedure which will act variably, according to 
context. Such a procedure can either be given a way of peering out at what is stored in 
memory and selecting its actions accordingly, or it can be explicitly fed a list of 
parameters which guide its choice of what actions to take. Sometimes both of these 
methods are used. In RTN terminology, choosing the sequence of actions to carry out 
amounts to choosing which pathway to follow. An RTN which has been souped up with 
parameters and conditions that control the choice of pathways inside it is called an 
Augmented Transition Network (ATN). A place where you might prefer ATN's to RTN's 
is in producing sensible-as distinguished from nonsensical-English sentences out of raw 
words, according to a grammar represented in a set of ATN's. The parameters and 
conditions would allow you to insert various semantic constraints, so that random 
juxtapositions like "a thankless brunch" would be prohibited. More on this in Chapter 
XVIII, however. 

Recursion in Chess Programs 

A classic example of a recursive procedure with parameters is one for choosing the "best" 
move in chess. The best move would seem to be the one which leaves your opponent in 
the toughest situation. Therefore, a test for goodness of a move is simply this: pretend 
you've made the move, and now evaluate the board from the point of view of your 
opponent. But how does your opponent evaluate the position? Well, he looks for his best 
move. That is, he mentally runs through all possible moves and evaluates them from what 
he thinks is your point of view, hoping they will look bad to you. But 

Recursive Structures and Processes 


notice that we have now defined "best move" recursively, simply maxim that what is best 
for one side is worst for the other. The procedure which looks for the best move operates 
by trying a move and then calling on itself in the role of opponent! As such, it tries 
another n calls on itself in the role of its opponent's opponent-that is, its 

This recursion can go several levels deep-but it's got to bottom out somewhere! 
How do you evaluate a board position without looking There are a number of useful 
criteria for this purpose, such as si number of pieces on each side, the number and type of 
pieces undo the control of the center, and so on. By using this kind of evaluation at the 
bottom, the recursive move-generator can pop back upwards an( evaluation at the top 
level of each different move. One of the parameters in the self-calling, then, must tell 
how many moves to look ahead. TI most call on the procedure will use some externally 
set value parameter. Thereafter, each time the procedure recursively calls must decrease 
this look-ahead parameter by 1 . That way, w parameter reaches zero, the procedure will 
follow the alternate pathway — the non-recursive evaluation. 

In this kind of game -playing program, each move investigate the generation of a 
so-called "look-ahead tree", with the move trunk, responses as main branches, counter- 
responses as subsidiary branches, and so on. In Figure 38 I have shown a simple look- 
ahead tree depicting the start of a tic-tar-toe game. There is an art to figuring to avoid 
exploring every branch of a look-ahead tree out to its tip. trees, people-not computers- 
seem to excel at this art; it is known that top-level players look ahead relatively little, 
compared to most chess programs - yet the people are far better! In the early days of 
compute people used to estimate that it would be ten years until a computer (or 

FIGURE 38. The branching tree of moves and countermoves at the start of c tic-tac-toe. 

Recursive Structures and Processes 


program) was world champion. But after ten years had passed, it seemed that the day a 
computer would become world champion was still more than ten years away ... This is 
just one more piece of evidence for the rather recursive 

Hofstadter's Law: It always takes longer than you expect, even when you take into 
account Hofstadter's Law. 

Recursion and Unpredictability 

Now what is the connection between the recursive processes of this Chapter, and the 
recursive sets of the preceding Chapter? The answer involves the notion of a recursively 
enumerable set. For a set to be r.e. means that it can be generated from a set of starting 
points (axioms), by the repeated application of rules of inference. Thus, the set grows and 
grows, each new element being compounded somehow out of previous elements, in a sort 
of "mathematical snowball". But this is the essence of recursion-something being defined 
in terms of simpler versions of itself, instead of explicitly. The Fibonacci numbers and 
the Lucas numbers are perfect examples of r.e. sets-snowballing from two elements by a 
recursive rule into infinite sets. It is just a matter of convention to call an r.e. set whose 
complement is also r.e. "recursive". 

Recursive enumeration is a process in which new things emerge from old things 
by fixed rules. There seem to be many surprises in such processes-for example the 
unpredictability of the Q-sequence. It might seem that recursively defined sequences of 
that type possess some sort of inherently increasing complexity of behavior, so that the 
further out you go, the less predictable they get. This kind of thought carried a little 
further suggests that suitably complicated recursive systems might be strong enough to 
break out of any predetermined patterns. And isn't this one of the defining properties of 
intelligence? Instead of just considering programs composed of procedures which can 
recursively call themselves, why not get really sophisticated, and invent programs which 
can modify themselves-programs which can act on programs, extending them, improving 
them, generalizing them, fixing them, and so on? This kind of "tangled recursion" 
probably lies at the heart of intelligence. 

Recursive Structures and Processes 



by Intervallic Augmentation 

Achilles and the Tortoise have just finished a delicious Chinese banquet for 
two, at the best Chinese restaurant in town. 

Achilles: You wield a mean chopstick, Mr. T. 

Tortoise: I ought to. Ever since my youth, I have had a fondness for Oriental cuisine. And you- 
did you enjoy your meal, Achilles? Achilles: Immensely. I'd not eaten Chinese food 
before. This meal was a splendid introduction. And now, are you in a hurry to go, or shall 
we just sit here and talk a little while? 

Tortoise: I'd love to talk while we drink our tea. Waiter! 

(A waiter comes up.) 

Could we have our bill, please, and some more tea? 
(The waiter rushes off.) 

Achilles: You may know more about Chinese cuisine than I do, Mr.T, I'll bet I know more about 

Japanese poetry than you do. Have you ever read any haiku? 
Tortoise: I'm afraid not. What is a haiku? 

Achilles: A haiku is a Japanese seventeen-syllable poem-or minipoem rather, which is evocative 
in the same way, perhaps, as a fragrant petal is, or a lily pond in a light drizzle. It 
generally consists of groups of: of five, then seven, then five syllables. 

Tortoise: Such compressed poems with seventeen syllables can't much meaning ... 

Achilles: Meaning lies as much in the mind of the reader as i haiku. 

Tortoise: Hmm ... That's an evocative statement. 

(The waiter arrives with their bill, another pot of tea, and two fortune cookies.) 

Thank you, waiter. Care for more tea, Achilles? 
Achilles: Please. Those little cookies look delicious. {Picks one up, bites I into it and begins to 

chew.) Hey! What's this funny thing inside? A piece of paper? 
Tortoise: That's your fortune, Achilles. Many Chinese restaurants give out fortune cookies with 

their bills, as a way of softening the blow. I frequent Chinese restaurants, you come to 

think of fortune cookies 

less as cookies than as message bearers Unfortunately you seem to have swallowed some 
of your fortune. What does the rest say? 

Achilles: It's a little strange, for all the letters are run together, with no spaces in between. 
Perhaps it needs decoding in some way? Oh, now I see. If you put the spaces back in 
where they belong, it says, "ONE WAR TWO EAR EWE". I can't quite make head or tail 
of that. Maybe it was a haiku-like poem, of which I ate the majority of syllables. 

Tortoise: In that case, your fortune is now a mere 5/17-haiku. And a curious image it evokes. If 
5/17-haiku is a new art form, then I'd say woe, 0, woe are we ... May I look at it? 

Achilles {handing the Tortoise the small slip of paper): Certainly. 

Tortoise: Why, when I "decode" it, Achilles, it comes out completely different! It's not a 5/17- 
haiku at all. It is a six-syllable message which says, "0 NEW ART WOE ARE WE". That 
sounds like an insightful commentary on the new art form of 5/17-haiku. 

Achilles: You're right. Isn't it astonishing that the poem contains its own commentary! 

Tortoise: All I did was to shift the reading frame by one unit-that is, shift all the spaces one unit 
to the right. 

Achilles: Let's see what your fortune says, Mr. Tortoise. 

Tortoise {deftly splitting open his cookie, reads): "Fortune lies as much in the hand of the eater as 
in the cookie." 

Achilles: Your fortune is also a haiku, Mr. Tortoise-at least it's got seventeen syllables in the 5-7- 
5 form. 

Tortoise: Glory be! I would never have noticed that, Achilles. It's the kind of thing only you 
would have noticed. What struck me more is what it says-which, of course, is open to 

Achilles: I guess it just shows that each of us has his own characteristic way of interpreting 
messages which we run across ... 

(Idly, Achilles gazes at the tea leaves on the bottom of his empty teacup.) 
Tortoise: More tea, Achilles? 

Achilles: Yes, thank you. By the way, how is your friend the Crab? I have been thinking about 

him a lot since you told me of your peculiar phonograph-battle. 
Tortoise: I have told him about you, too, and he is quite eager to meet you. He is getting along 

just fine. In fact, he recently made a new acquisition in the record player line: a rare type 

of jukebox. 

Achilles: Oh, would you tell me about it? I find jukeboxes, with their flashing colored lights and 

silly songs, so quaint and reminiscent of bygone eras. 
Tortoise: This jukebox is too large to fit in his house, so he had a shed specially built in back for 


Achilles: I can't imagine why it would be so large, unless it has an unusually large selection of 

records. Is that it? 
Tortoise: As a matter of fact, it has exactly one record. 

Achilles: What? A jukebox with only one record? That's a contradiction in terms. Why is the 

jukebox so big, then? Is its single record gigantic — twenty feet in diameter? 
Tortoise: No, it's just a regular jukebox-style record. 
Achilles: Now, Mr. Tortoise, you must be joshing me. After all, what I 
of a jukebox is it that has only a single song? 
Tortoise: Who said anything about a single song, Achilles? 

Achilles: Every- jukebox I've ever run into obeyed the fundamental jukebox-axiom: "One record, 
one song". 

Tortoise: This jukebox is different, Achilles. The one record sits vertically, suspended, and 
behind it there is a small but elaborate network of overhead rails, from which hang 
various record players. When push a pair of buttons, such as B-l, that selects one of the 
record players. This triggers an automatic mechanism that starts the record player 
squeakily rolling along the rusty tracks. It gets shunted alongside the record-then it clicks 
into playing position. 

Achilles: And then the record begins spinning and music comes out — right? 

Tortoise: Not quite. The record stands still-it's the record player which rotates. 

Achilles: I might have known. But how, if you have but one record to play can you get more than 
one song out of this crazy contraption? 

Tortoise: I myself asked the Crab that question. He merely suggested I try it out. So I fished a 
quarter from my pocket (you get three plays for a quarter), stuffed it in the slot, and hit 
buttons B-l, then C-3 then B-10-all just at random. 

Achilles: So phonograph B-l came sliding down the rail, I suppose, plugged itself into the 
vertical record, and began spinning? 

Tortoise: Exactly. The music that came out was quite agreeable, based the famous old tune B-A- 
C-H, which I believe you remember. 

Achilles: Could I ever forget it? 

Tortoise: This was record player B-l. Then it finished, and was s rolled back into its hanging 

position, so that C-3 could be slid into position. 
Achilles: Now don't tell me that C-3 played another song? 
Tortoise: It did just that. 

Achilles: Ah, I understand. It played the flip side of the first song, or another band on the same 

Tortoise: No, the record has grooves only on one side, and has only a single band. 

Achilles: I don't understand that at all. You CAN'T pull different songs out of the same record! 
Tortoise: That's what I thought until I saw Mr. Crab's jukebox. Achilles: How did the second 
song go? 

Tortoise: That's the interesting thing ... It was a song based on the melody C-A-G-E. 
Achilles: That's a totally different melody! 
Tortoise: True. 

Achilles: And isn't John Cage a composer of modern music? I seem to remember reading about 

him in one of my books on haiku. 
Tortoise: Exactly. He has composed many celebrated pieces, such as 4'33", a three-movement 

piece consisting of silences of different lengths. It's wonderfully expressive-if you like 

that sort of thing. 

Achilles: I can see where if I were in a loud and brash cafe I might gladly pay to hear Cage's 

4'33" on a jukebox. It might afford some relief! 
Tortoise: Right-who wants to hear the racket of clinking dishes and jangling silverware? By the 

way, another place where 4'33" would come in handy is the Hall of Big Cats, at feeding 


Achilles: Are you suggesting that Cage belongs in the zoo? Well, I guess that makes some sense. 

But about the Crab's jukebox ... I am baffled. How could both "BACH" and "CAGE" be 

coded inside a single record at once? 
Tortoise: You may notice that there is some relation between the two, Achilles, if you inspect 

them carefully. Let me point the way. What do you get if you list the successive intervals 

in the melody B-A-C-H? 
Achilles: Let me see. First it goes down one semitone, from B to A (where B is taken the 

German way); then it rises three semitones to C; and finally it falls one semitone, to H. 

That yields the pattern: 


Tortoise: Precisely. What about C-A-G-E, now? 

Achilles: Well, in this case, it begins by falling three semitones, then ten semitones (nearly an 
octave), and finally falls three more semitones. That means the pattern is: 

-3, +10, -3. 

It's very much like the other one, isn't it? 
Tortoise: Indeed it is. They have exactly the same "skeleton", in a certain sense. You can make 
C-A-G-E out of B-A-C-H by multiplying all the intervals by 31/3, and taking the nearest 
whole number. 

Achilles: Well, blow me down and pick me up! So does that mean that only 

some sort of skeletal code is present in the grooves, and that the various record players 

add their own interpretations to that code? 
Tortoise: I don't know, for sure. The cagey Crab wouldn't fill me in on the details. But I did get 

to hear a third song, when record player B-l swiveled into place. 
Achilles: How did it go? 

Tortoise: The melody consisted of enormously wide intervals, and we B-C-A-H. 

It can be gotten from the CAGE pattern by yet another multiplication by 3%3, and 
rounding to whole numbers. 
Achilles: Is there a name for this kind of interval multiplication? 

Tortoise: One could call it "intervallic augmentation". It is similar to tl canonic device of 
temporal augmentation, where all the time values notes in a melody get multiplied by 
some constant. There, the effect just to slow the melody down. Here, the effect is to 
expand the melodic range in a curious way. 

Achilles: Amazing. So all three melodies you tried were intervallic augmentations of one single 
underlying groove-pattern in the record: 

Tortoise: That's what I concluded. 

Achilles: I find it curious that when you augment BACH you get CAGE and when you augment 
CAGE over again, you get BACH back, except jumbled up inside, as if BACH had an 
upset stomach after passing through the intermediate stage of CAGE. 

Tortoise: That sounds like an insightful commentary on the new art form of Cage. 

The interval pattern in semitones was: 





The Location of Meaning 

When Is One Thing Not Always the Same? 

LAST CHAPTER, WE came upon the question, "When are two things the same?" In this 
Chapter, we will deal with the flip side of that question: "When is one thing not always 
the same?" The issue we are broaching is whether meaning can be said to be inherent in a 
message, or whether meaning is always manufactured by the interaction of a mind or a 
mechanism with a message-as in the preceding Dialogue. In the latter case, meaning 
could not said to be located in any single place, nor could it be said that a message has 
any universal, or objective, meaning, since each observer could bring its own meaning to 
each message. But in the former case, meaning would have both location and 
universality. In this Chapter, I want to present the case for the universality of at least 
some messages, without, to be sure, claiming it for all messages. The idea of an 
"objective meaning" of a message will turn out to be related, in an interesting way, to the 
simplicity with which intelligence can be described. 

Information-Bearers and Information- Revealers 

I'll begin with my favorite example: the relationship between records, music, and record 
players. We feel quite comfortable with the idea that a record contains the same 
information as a piece of music, because of the existence of record players, which can 
"read" records and convert the groove-patterns into sounds. In other words, there is an 
isomorphism between groove-patterns and sounds, and the record player is a mechanism 
which physically realizes that isomorphism. It is natural, then, to think of the record as an 
information-bearer, and the record-player as an information-revealer. A second example 
of these notions is given by the pq-system. There, the "information-bearers" are the 
theorems, and the "information-revealer" is the interpretation, which is so transparent that 
we don't need any electrical machine to help us extract the information from pq- 

One gets the impression from these two examples that isomorphisms and 
decoding mechanisms (i.e., information-revealers) simply reveal information which is 
intrinsically inside the structures, waiting to be "pulled out". This leads to the idea that 
for each structure, there are certain pieces of information which can be pulled out of it, 
while there are other pieces of information which cannot be pulled out of it. But what 
does this phrase 

The Location of Meaning 


"pull out" really mean? How hard are you allowed to pull? There are c where by 
investing sufficient effort, you can pull very recondite piece of information out of certain 
structures. In fact, the pulling-out may inv such complicated operations that it makes you 
feel you are putting in n information than you are pulling out. 

Genotype and Phenotype 

Take the case of the genetic information commonly said to reside in double helix of 
deoxyribonucleic acid (DNA). A molecule of DNA - a genotype-is converted into a 
physical organism-a phenotype-by a complex process, involving the manufacture of 
proteins, the replication the DNA, the replication of cells, the gradual differentiation of 
cell types and so on. Incidentally, this unrolling of phenotype from genotype epigenesis- 
is the most tangled of tangled recursions, and in Chapter we shall devote our full attention 
to it. Epigenesis is guided by a se enormously complex cycles of chemical reactions and 
feedback loops the time the full organism has been constructed, there is not even remotest 
similarity between its physical characteristics and its genotype. 

And yet, it is standard practice to attribute the physical structure of organism to 
the structure of its DNA, and to that alone. The first evidence for this point of view came 
from experiments conducted by Oswald A, in 1946, and overwhelming corroborative 
evidence has since been amassed Avery's experiments showed that, of all the biological 
molecules, only E transmits hereditary properties. One can modify other molecules it 
organism, such as proteins, but such modifications will not be transmitted to later 
generations. However, when DNA is modified, all successive generations inherit the 
modified DNA. Such experiments show that the only of changing the instructions for 
building a new organism is to change DNA-and this, in turn, implies that those 
instructions must be cc somehow in the structure of the DNA. 

Exotic and Prosaic Isomorphisms 

Therefore one seems forced into accepting the idea that the DNA's structure contains the 
information of the pheno type's structure, which is to the two are isomorphic. However, 
the isomorphism is an exotic one, by w] I mean that it is highly nontrivial to divide the 
phenotype and genotype into "parts" which can be mapped onto each other. Prosaic 
isomorphic by contrast, would be ones in which the parts of one structure are easily 
mappable onto the parts of the other. An example is the isomorphism between a record 
and a piece of music, where one knows that to any so in the piece there exists an exact 
"image" in the patterns etched into grooves, and one could pinpoint it arbitrarily 
accurately, if the need arose Another prosaic isomorphism is that between Gplot and any 
of its internal butterflies. 

The Location of Meaning 


The isomorphism between DNA structure and phenotype structure is anything but 
prosaic, and the mechanism which carries it out physically is awesomely complicated. 
For instance, if you wanted to find some piece of your DNA which accounts for the shape 
of your nose or the shape of your fingerprint, you would have a very hard time. It would 
be a little like trying to pin down the note in a piece of music which is the carrier of the 
emotional meaning of the piece. Of course there is no such note, because the emotional 
meaning is carried on a very high level, by large "chunks" of the piece, not by single 
notes. Incidentally, such "chunks" are not necessarily sets of contiguous notes; there may 
be disconnected sections which, taken together, carry some emotional meaning. 

Similarly, "genetic meaning"-that is, information about phenotype structure-is 
spread all through the small parts of a molecule of DNA, although nobody understands 
the language yet. (Warning: Understanding this "language" would not at all be the same 
as cracking the Genetic Code, something which took place in the early 1960's. The 
Genetic Code tells how to translate short portions of DNA into various amino acids. 
Thus, cracking the Genetic Code is comparable to figuring out the phonetic values of the 
letters of a foreign alphabet, without figuring out the grammar of the language or the 
meanings of any of its words. The cracking of the Genetic Code was a vital step on the 
way to extracting the meaning of DNA strands, but it was only the first on a long path 
which is yet to be trodden.) 

Jukeboxes and Triggers 

The genetic meaning contained in DNA is one of the best possible examples of implicit 
meaning. In order to convert genotype into phenotype, a set of mechanisms far more 
complex than the genotype must operate on the genotype. The various parts of the 
genotype serve as triggers for those mechanisms. A jukebox-the ordinary type, not the 
Crab type [-provides a useful analogy here: a pair of buttons specifies a very complex 
action to be taken by the mechanism, so that the pair of buttons could well be described 
as "triggering" the song which is played. In the process which converts genotype into 
phenotype, cellular jukeboxes-if you will pardon the notion! -accept "button-pushings" 
from short excerpts from a long strand of DNA, and the "songs" which they play are 
often prime ingredients in the creation of further "jukeboxes". It is as if the output of real 
jukeboxes, instead of being love ballads, were songs whose lyrics told how to build more 
complex jukeboxes ... Portions of the DNA trigger the manufacture of proteins; those 
proteins trigger hundreds of new reactions; they in turn trigger the replicating-operation 
which, in several steps, copies the DNA-and on and on ... This gives a sense of how 
recursive the whole process is. The final result of these many-triggered triggerings is the 
phenotype-the individual. And one says that the phenotype is the revelation-the "pulling- 
out"-of the information that was present in the DNA to start with, latently. (The term 
"revelation" in this context is due to 

The Location of Meaning 


Jacques Monod, one of the deepest and most original of twentieth-century molecular 

Now no one would say that a song coming out of the loudspeaker of jukebox 
constitutes a "revelation" of information inherent in the pair buttons which were pressed, 
for the pair of buttons seem to be mere triggers, whose purpose is to activate information- 
bearing portions of the jukebox mechanism. On the other hand, it seems perfectly 
reasonable to call t extraction of music from a record a "revelation" of information 
inherent the record, for several reasons: 

(1) the music does not seem to be concealed in the mechanism of the record player; 

(2) it is possible to match pieces of the input (the record) with pieces of the output 
(the music) to an arbitrary degree of accuracy; 

(3) it is possible to play other records on the same record player and get other 
sounds out; 

(4) the record and the record player are easily separated from one another. 

It is another question altogether whether the fragments of a smashed record contain 
intrinsic meaning. The edges of the separate pieces together and in that way allow the 
information to be reconstituted-t something much more complex is going on here. Then 
there is the question of the intrinsic meaning of a scrambled telephone call ... There is a 
vast spectrum of degrees of inherency of meaning. It is interesting to try place epigenesis 
in this spectrum. As development of an organism takes place, can it be said that the 
information is being "pulled out" of its DNA? Is that where all of the information about 
the organism's structure reside; 

DNA and the Necessity of Chemical Context 

In one sense, the answer seems to be yes, thanks to experiments li Avery's. But in another 
sense, the answer seems to be no, because so much of the pulling-out process depends on 
extraordinarily complicated cellular chemical processes, which are not coded for in the 
DNA itself. The DNA relies on the fact that they will happen, but does not seem to 
contain a code which brings them about. Thus we have two conflicting views on the 
nature of the information in a genotype. One view says that so much of t information is 
outside the DNA that it is not reasonable to look upon the DNA as anything more than a 
very intricate set of triggers, like a sequence of buttons to be pushed on a jukebox; 
another view says that the information is all there, but in a very implicit form. 

Now it might seem that these are just two ways of saying the same thing, but that 
is not necessarily so. One view says that the DNA is quite meaningless out of context; the 
other says that even if it were taken out context, a molecule of DNA from a living being 
has such a compelling inner 

The Location of Meaning 


logic to its structure that its message could be deduced anyway. To put it as succinctly as 
possible, one view says that in order for DNA to have meaning, chemical context is 
necessary; the other view says that only intelligence is necessary to reveal the "intrinsic 
meaning" of a strand of DNA. 

An Unlikely UFO 

We can get some perspective on this issue by considering a strange hypothetical 
event. A record of David Oistrakh and Lev Oborin playing Bach's sonata in F Minor for 
violin and clavier is sent up in a satellite. From the satellite it is then launched on a course 
which will carry it outside of the solar system, perhaps out of the entire galaxy just a thin 
plastic platter with a hole in the middle, swirling its way through intergalactic space. It 
has certainly lost its context. How much meaning does it carry? 

If an alien civilization were to encounter it, they would almost certainly be struck 
by its shape, and would probably be very interested in it. Thus immediately its shape, 
acting as a trigger, has given them some information: that it is an artifact, perhaps an 
information-bearing artifact. This idea-communicated, or triggered, by the record itself- 
now creates a new context in which the record will henceforth be perceived. The next 
steps in the decoding might take considerably longer-but that is very hard for us to assess. 
We can imagine that if such a record had arrived on earth in Bach's time, no one would 
have known what to make of it, and very likely it would not have gotten deciphered. But 
that does not diminish our conviction that the information was in principle there; we just 
know that human knowledge in those times was not very sophisticated with respect to the 
possibilities of storage, transformation, and revelation of information. 

Levels of Understanding of a Message 

Nowadays, the idea of decoding is extremely widespread; it is a significant part of the 
activity of astronomers, linguists, archaeologists, military specialists, and so on. It is 
often suggested that we may be floating in a sea of radio messages from other 
civilizations, messages which we do not yet know how to decipher. And much serious 
thought has been given to the techniques of deciphering such a message. One of the main 
problems perhaps the deepest problem-is the question, "How will we recognize the fact 
that there is a message at all? How to identify a frame?" The sending of a record seems to 
be a simple solution-its gross physical structure is very attention-drawing, and it is at 
least plausible to us that it would trigger, in any sufficiently great intelligence, the idea of 
looking for information hidden in it. However, for technological reasons, sending of solid 
objects to other star systems seems to be out of the question. Still, that does not prevent 
our thinking about the idea. 

Now suppose that an alien civilization hit upon the idea that the appropriate 
mechanism for translation of the record is a machine which 

The Location of Meaning 


converts the groove-patterns into sounds. This would still be a far cry from a true 
deciphering. What, indeed, would constitute a successful deciphering of such a record? 
Evidently, the civilization would have to be able to ma sense out of the sounds. Mere 
production of sounds is in itself hart worthwhile, unless they have the desired triggering 
effect in the brains that is the word) of the alien creatures. And what is that desired 
effect? would be to activate structures in their brains which create emotional effects in 
them which are analogous to the emotional effects which experience in hearing the piece. 
In fact, the production of sounds cot even be bypassed, provided that they used the record 
in some other way get at the appropriate structures in their brains. (If we humans had a w 
of triggering the appropriate structures in our brains in sequential order, as music does, 
we might be quite content to bypass the sounds-but it see] extraordinarily unlikely that 
there is any way to do that, other than via o ears. Deaf composers-Beethoven, Dvofak, 
Faure-or musicians who can "hear" music by looking at a score, do not give the lie to this 
assertion, for such abilities are founded upon preceding decades of direct auditory 

Here is where things become very unclear. Will beings of an alien civilization 
have emotions? Will their emotions-supposing they have some-be mappable, in any 
sense, onto ours? If they do have emotions somewhat like ours, do the emotions cluster 
together in somewhat the same way as ours do? Will they understand such amalgams as 
tragic beauty courageous suffering? If it turns out that beings throughout the universe do 
share cognitive structures with us to the extent that even emotions overlap, then in some 
sense, the record can never be out of its natural context; that context is part of the scheme 
of things, in nature. And if such is the case, then it is likely that a meandering record, if 
not destroyed en route, would eventually get picked up by a being or group of beings, at 
get deciphered in a way which we would consider successful. 

"Imaginary Spacescape" 

In asking about the meaning of a molecule of DNA above, I used t phrase 
"compelling inner logic"; and I think this is a key notion. To illustrate this, let us slightly 
modify our hypothetical record-into-spa event by substituting John Cage's "Imaginary 
Landscape no. 4" for the Bach. This piece is a classic of aleatoric, or chance, music- 
music who structure is chosen by various random processes, rather than by an attempt to 
convey a personal emotion. In this case, twenty-four performers attar themselves to the 
twenty-four knobs on twelve radios. For the duration the piece they twiddle their knobs in 
aleatoric ways so that each radio randomly gets louder and softer, switching stations all 
the while. The tot sound produced is the piece of music. Cage's attitude is expressed in 14 
own words: "to let sounds be themselves, rather than vehicles for man made theories or 
expressions of human sentiments." 

The Location of Meaning 


Now imagine that this is the piece on the record sent out into space. It would be 
extraordinarily unlikely-if not downright impossible-for an alien civilization to 
understand the nature of the artifact. They would probably be very puzzled by the 
contradiction between the frame message ("I am a message; decode me"), and the chaos 
of the inner structure. There are few "chunks" to seize onto in this Cage piece, few 
patterns which could guide a decipherer. On the other hand, there seems to be, in a Bach 
piece, much to seize onto-patterns, patterns of patterns, and so on. We have no way of 
knowing whether such patterns are universally appealing. We do not know enough about 
the nature of intelligence, emotions, or music to say whether the inner logic of a piece by 
Bach is so universally compelling that its meaning could span galaxies. 

However, whether Bach in particular has enough inner logic is not the issue here; 
the issue is whether any message has, per se, enough compelling inner logic that its 
context will be restored automatically whenever intelligence of a high enough level 
comes in contact with it. If some message did have that context-restoring property, then it 
would seem reasonable to consider the meaning of the message as an inherent property of 
the message. 

The Heroic Decipherers 

Another illuminating example of these ideas is the decipherment of ancient texts written 
in unknown languages and unknown alphabets. The intuition feels that there is 
information inherent in such texts, whether or not we succeed in revealing it. It is as 
strong a feeling as the belief that there is meaning inherent in a newspaper written in 
Chinese, even if we are completely ignorant of Chinese. Once the script or language of a 
text has been broken, then no one questions where the meaning resides: clearly it resides 
in the text, not in the method of decipherment just as music resides in a record, not inside 
a record player! One of the ways that we identify decoding mechanisms is by the fact that 
they do not add any meaning to the signs or objects which they take as input; they merely 
reveal the intrinsic meaning of those signs or objects. A jukebox is not a decoding 
mechanism, for it does not reveal any meaning belonging to its input symbols; on the 
contrary, it supplies meaning concealed inside itself. 

Now the decipherment of an ancient text may have involved decades of labor by 
several rival teams of scholars, drawing on knowledge stored in libraries all over the 
world ... Doesn't this process add information, too? Just how intrinsic is the meaning of a 
text, when such mammoth efforts are required in order to find the decoding rules? Has 
one put meaning into the text, or was that meaning already there? My intuition says that 
the meaning was always there, and that despite the arduousness of the pulling-out 
process, no meaning was pulled out that wasn't in the text to start with. This intuition 
comes mainly from one fact: I feel that the result was inevitable; that, had the text not 
been deciphered by this group at this time, it would have been deciphered by that group 
at that time-and it would have come 

The Location of Meaning 


-w^wsis i iaiEfl^iiuttfls»i)w*trT'3 ri .'jii:if=«tii; - 

FIGURE 39. The Rosetta Stone [courtesy of the British Museum. 

out the same way. That is why the meaning is part of the text itself; it acts upon 
intelligence in a predictable way. Generally, we can say: meaning is part of an object to 
the extent that it acts upon intelligence in a predictable way. 

In Figure 39 is shown the Rosetta stone, one of the most precious of all historic 
discoveries. It was the key to the decipherment of Egyptian hieroglyphics, for it contains 
parallel text in three ancient scripts: hieroglyphic demotic characters, and Greek. The 
inscription on this basalt stele was firs deciphered in 1821 by Jean Francois Champollion, 
the "father of Egyptology"; it is a decree of priests assembled at Memphis in favor of 
Ptolemy Epiphanes. 

The Location of Meaning 


Three Layers of Any Message 

In these examples of decipherment of out-of-context messages, we can separate 
out fairly clearly three levels of information: (1) the frame message; (2) the outer 
message; (3) the inner message. The one we are most familiar with is (3), the inner 
message; it is the message which is supposed to be transmitted: the emotional 
experiences in music, the phenotype in genetics, the royalty and rites of ancient 
civilizations in tablets, etc. 

To understand the inner message is to have extracted the meaning intended by the 


The frame message is the message "I am a message; decode me if you can!"; and 
it is implicitly conveyed by the gross structural aspects of any information-bearer. 

To understand the frame message is to recognize the need for a decoding- 


If the frame message is recognized as such, then attention is switched to level (2), 
the outer message. This is information, implicitly carried by symbol-patterns and 
structures in the message, which tells how to decode the inner message. 

To understand the outer message is to build, or know how to build, the correct 
decoding mechanism for the inner message. 

This outer level is perforce an implicit message, in the sense that the sender cannot ensure 
that it will be understood. It would be a vain effort to send instructions which tell how to 
decode the outer message, for they would have to be part of the inner message, which can 
only be understood once the decoding mechanism has been found. For this reason, the 
outer message is necessarily a set of triggers, rather than a message which can be 
revealed by a known decoder. 

The formulation of these three "layers" is only a rather crude beginning at 
analyzing how meaning is contained in messages. There may be layers and layers of 
outer and inner messages, rather than just one of each. Think, for instance, of how 
intricately tangled are the inner and outer messages of the Rosetta stone. To decode a 
message fully, one would have to reconstruct the entire semantic structure which 
underlay its creation and thus to understand the sender in every deep way. Hence one 
could throw away the inner message, because if one truly understood all the finesses of 
the outer message, the inner message would be reconstructible. 

The book After Babel, by George Steiner, is a long discussion of the interaction 
between inner and outer messages (though he never uses that terminology). The tone of 
his book is given by this quote: 

We normally use a shorthand beneath which there lies a wealth of subconscious, 
deliberately concealed or declared associations so extensive and intri- 

The Location of Meaning 


cate that they probably equal the sum and uniqueness of our status as an individual person.' 

Thoughts along the same lines are expressed by Leonard B. Meyer, in h book Music, the 
Arts, and Ideas: 

The way of listening to a composition by Elliott Carter is radically different from the way 
of listening appropriate to a work by John Cage. Similarly, a novel by Beckett must in a 
significant sense be read differently from one by Bellow. A painting by Willem de 
Kooning and one by Andy Warhol require different perceptional-cognitive attitudes.' 

Perhaps works of art are trying to convey their style more than an thing else. In 
that case, if you could ever plumb a style to its very bottom you could dispense with the 
creations in that style. "Style", "outer message "decoding technique" -all ways of 
expressing the same basic idea. 

Schrodinger's Aperiodic Crystals 

What makes us see a frame message in certain objects, but none in other; Why 
should an alien civilization suspect, if they intercept an errant record that a message lurks 
within? What would make a record any different from a meteorite? Clearly its geometric 
shape is the first clue that "something funny is going on". The next clue is that, on a more 
microscopic scale, consists of a very long aperiodic sequence of patterns, arranged in a 
spiral If we were to unwrap the spiral, we would have one huge linear sequence (around 
2000 feet long) of minuscule symbols. This is not so different from a DNA molecule, 
whose symbols, drawn from a meager "alphabet" of four different chemical bases, are 
arrayed in a one-dimensional sequence, an then coiled up into a helix. Before Avery had 
established the connection between genes and DNA, the physicist Erwin Schrodinger 
predicted, o purely theoretical grounds, that genetic information would have to be stored 
in "aperiodic crystals", in his influential book What Is Lifel In fact books themselves are 
aperiodic crystals contained inside neat geometric forms. These examples suggest that, 
where an aperiodic crystal is found "packaged" inside a very regular geometric structure, 
there may lurk a inner message. (I don't claim this is a complete characterization of frame 
messages; however, it is a fact that many common messages have frame messages of this 
description. See Figure 40 for some good examples.) 

Languages for the Three Levels 

The three levels are very clear in the case of a message found in a bottle washed up on a 
beach. The first level, the frame message, is found when one picks up the bottle and sees 
that it is sealed, and contains a dry piece c paper. Even without seeing writing, one 
recognizes this type of artifact an information-bearer, and at this point it would take an 
extraordinary almost inhuman-lack of curiosity, to drop the bottle and not look further. 

The Location of Meaning 


pfir *r 


i TEJum^tMnti bmumn 
luflvnuixjupruj-jsu Iv In mo tun am 

llkim»n^Iflt]!*llJmjn m®, mta llftr mm 

uaiwflfil.ileinvfiptifiaijl.utiui m<< iion 
nawVljj ptitnjjLiarflnFifujflltrl^fi 1 


^ppg/ftlU Ul_^j(5^(I® 9LJL?Lj$iu UMa^'S C?^ 

ustwasafl iGWsfrsir Qsusssi^mj <j)filaw£Gir tflss 
(^sapsij. ^aswuSgjai ^hpfpt^A^ @*wj fifes 

i-Ji,-"*/^ qa» it si_as»®. ,3*1 >,«•.,>>» 
















(urtroti oAucnsI ol^^lfra 0 

"f^w <=T<ic<ri 

The Location of Meaning 


Next, one opens the bottle and examines the marks on the paper. Perhaps, they are in 
Japanese; this can be discovered without any of the inner message being understood-it 
merely comes from a recognition of 1 characters. The outer message can be stated as an 
English sentence: "I in Japanese." Once this has been discovered, then one can proceed 
the inner message, which may be a call for help, a haiku poem, a lover's lament ... 

It would be of no use to include in the inner message a translation the sentence 
"This message is in Japanese", since it would take someone who knew Japanese to read 
it. And before reading it, he would have recognize the fact that, as it is in Japanese, he 
can read it. You might try wriggle out of this by including translations of the statement 
"This mess2 is in Japanese" into many different languages. That would help it practical 
sense, but in a theoretical sense the same difficulty is there. . English-speaking person 
still has to recognize the "Englishness" of the message; otherwise it does no good. Thus 
one cannot avoid the problem that one has to find out how to decipher the inner message 
from the outside the inner message itself may provide clues and confirmations, but those ; 
at best triggers acting upon the bottle finder (or upon the people whom enlists to help). 

Similar kinds of problem confront the shortwave radio listener. First he has to 
decide whether the sounds he hears actually constitute a message or are just static. The 
sounds in themselves do not give the answer, not e% in the unlikely case that the inner 
message is in the listener's own native language, and is saying, "These sounds actually 
constitute a message a are not just static!" If the listener recognizes a frame message in 
the soup then he tries to identify the language the broadcast is in-and clearly, he is still on 
the outside; he accepts triggers from the radio, but they cam explicitly tell him the 

It is in the nature of outer messages that they are not conveyed in any 

FIGURE 40. A collage of scripts. Uppermost on the left is an inscription in the un ciphered 
boustrophedonic writing system from Easter Island, in which every second lin upside down. The 
characters are chiseled on a wooden tablet, 4 inches by 35 inches. Mov clockwise, we encounter 
vertically written Mongolian: above, present-day Mongolian, below, a document dating from 
1 314. Then we come to a poem in Bengali by Rabindran Tagore in the bottom righthand corner. 
Next to it is a newspaper headline in Malayalam (II Kerala, southern India), above which is the 
elegant curvilinear language Tamil (F Kerala). The smallest entry is part of a folk tale in 
Buginese (Celebes Island, Indonesia). In center of the collage is a paragraph in the Thai 
language, and above it a manuscript in Rn dating from the fourteenth century, containing a 
sample of the provincial law of Scania (so Sweden). Finally, wedged in on the left is a section of 
the laws of Hammurabi, written Assyrian cuneiform. As an outsider, I feel a deep sense of 
mystery as I wonder how meanin cloaked in the strange curves and angles of each of these 
beautiful aperiodic crystals. Info there is content. [From Ham Jensen, Sign, Symbol, and Script 
(New York: G. Putnam's S. 1969), pp. 89 (cuneiform), 356 (Easter Island) , 386, 417 (Mongolian), 
552 (Runic); from Keno Katzner, The Languages of the World (New York: Funk & Wagnalls, 
1975), pp. 190 (Bengali), 

(Buginese); from I. A. Richards and Christine Gibson, English Through Pictures (New Y 
Washington Square Press, 1960), pp. 73 (Tamil), 82 (Thai). 

The Location of Meaning 


explicit language. To find an explicit language in which to convey outer messages would 
not be a breakthrough- it would be a contradiction in terms! It is always the listener's 
burden to understand the outer message. Success lets him break through into the inside, at 
which point the ratio of triggers to explicit meanings shifts drastically towards the latter. 
By comparison with the previous stages, understanding the inner message seems 
effortless. It is as if it just gets pumped in. 

The "Jukebox" Theory of Meaning. 

These examples may appear to be evidence for the viewpoint that no message has 
intrinsic meaning, for in order to understand any inner message, no matter how simple it 
is, one must first understand its frame message and its outer message, both of which are 
carried only by triggers (such as being written in the Japanese alphabet, or having 
spiraling grooves, etc.). It begins to seem, then, that one cannot get away from a 
"jukebox" theory of meaning-the doctrine that no message contains inherent meaning, 
because, before any message can be understood, it has to be used as the input to some 
"jukebox", which means that information contained in the "jukebox" must be added to the 
message before it acquires meaning. 

This argument is very similar to the trap which the Tortoise caught Achilles in, in 
Lewis Carroll's Dialogue. There, the trap was the idea that before you can use any rule, 
you have to have a rule which tells you how to use that rule; in other words, there is an 
infinite hierarchy of levels of rules, which prevents any rule from ever getting used. Here, 
the trap is the idea that before you can understand any message, you have to have a 
message which tells you how to understand that message; in other words, there is an 
infinite hierarchy of levels of messages, which prevents any message from ever getting 
understood. However, we all know that these paradoxes are invalid, for rules do get used, 
and messages do get understood. How come? 

Against the Jukebox Theory 

This happens because our intelligence is not disembodied, but is instantiated in physical 
objects: our brains. Their structure is due to the long process of evolution, and their 
operations are governed by the laws of physics. Since they are physical entities, our 
brains run without being told how to run. So it is at the level where thoughts are produced 
by physical law that Carroll's rule-paradox breaks down; and likewise, it is at the level 
where a brain interprets incoming data as a message that the message-paradox breaks 
down. It seems that brains come equipped with "hardware" for recognizing that certain 
things are messages, and for decoding those messages. This minimal inborn ability to 
extract inner meaning is what allows the highly recursive, snowballing process of 
language acquisition to take place. The inborn hardware is like a jukebox: it supplies the 
additional information which turns mere triggers into complete messages. 

The Location of Meaning 


Meaning Is Intrinsic If Intelligence Is Natural 

Now if different people's "jukeboxes" had different "songs" in then responded to given 
triggers in completely idiosyncratic ways, the would have no inclination to attribute 
intrinsic meaning to those tri; However, human brains are so constructed that one brain 
responds in much the same way to a given trigger as does another brain, all other t being 
equal. This is why a baby can learn any language; it responds to triggers in the same way 
as any other baby. This uniformity of "human jukeboxes" establishes a uniform 
"language" in which frame message outer messages can be communicated. If, 
furthermore, we believe human intelligence is just one example of a general phenomena 
nature -the emergence of intelligent beings in widely varying contexts then presumably 
the "language" in which frame messages and outer sages are communicated among 
humans is a "dialect" of a universal gauge by which intelligences can communicate with 
each other. Thus, would be certain kinds of triggers which would have "universal 
triggering power", in that all intelligent beings would tend to respond to them i same way 
as we do. 

This would allow us to shift our description of where meaning located. We could 
ascribe the meanings (frame, outer, and inner) message to the message itself, because of 
the fact that deciphering mechanisms are themselves universal-that is, they are 
fundamental f of nature which arise in the same way in diverse contexts. To make it 
concrete, suppose that "A-5" triggered the same song in all jukeboxes suppose moreover 
that jukeboxes were not man-made artifacts, but w occurring natural objects, like galaxies 
or carbon atoms. Under such circumstances, we would probably feel justified in calling 
the universal triggering power of "A-5" its "inherent meaning"; also, "A-5" would merit: 
the name of "message", rather than "trigger", and the song would indeed "revelation" of 
the inherent, though implicit, meaning of "A-5". 

Earth Chauvinism 

This ascribing of meaning to a message comes from the invariance c processing of the 
message by intelligences distributed anywhere ii universe. In that sense, it bears some 
resemblance to the ascribing of to an object. To the ancients, it must have seemed that an 
object's weight was an intrinsic property of the object. But as gravity became understood, 
it was realized that weight varies with the gravitational field the object is immersed in. 
Nevertheless, there is a related quantity, the mass, which not vary according to the 
gravitational field; and from this invariance the conclusion that an object's mass was an 
intrinsic property of the object itself. If it turns out that mass is also variable, according to 
context, then will backtrack and revise our opinion that it is an intrinsic property of an 
object. In the same way, we might imagine that there could exist other 

The Location of Meaning 


kinds of "jukeboxes"-intelligences-which communicate among each other via messages 
which we would never recognize as messages, and who also would never recognize our 
messages as messages. If that were the case, then the claim that meaning is an intrinsic 
property of a set of symbols would have to be reconsidered. On the other hand, how 
could we ever realize that such beings existed? 

It is interesting to compare this argument for the inherency of meaning with a 
parallel argument for the inherency of weight. Suppose one defined an object's weight as 
"the magnitude of the downward force which the object exerts when on the surface of the 
planet Earth". Under this definition, the downward force which an object exerts when on 
the surface of Mars would have to be given another name than "weight". This definition 
makes weight an inherent property, but at the cost of geocentricity" Earth chauvinism". It 
would be like "Greenwich chauvinism"-refusing to accept local time anywhere on the 
globe but in the GMT time zone. It is an unnatural way to think of time. 

Perhaps we are unknowingly burdened with a similar chauvinism with respect to 
intelligence, and consequently with respect to meaning. In our chauvinism, we would call 
any being with a brain sufficiently much like our own "intelligent", and refuse to 
recognize other types of objects as intelligent. To take an extreme example, consider a 
meteorite which, instead of deciphering the outer-space Bach record, punctures it with 
colossal indifference, and continues in its merry orbit. It has interacted with the record in 
a way which we feel disregards the record's meaning. Therefore, we might well feel 
tempted to call the meteorite "stupid". But perhaps we would thereby do the meteorite a 
disservice. Perhaps it has a "higher intelligence" which we in our Earth chauvinism 
cannot perceive, and its interaction with the record was a manifestation of that higher 
intelligence. Perhaps, then, the record has a "higher meaning "-totally different from that 
which we attribute to it; perhaps its meaning depends on the type of intelligence 
perceiving it. Perhaps. 

It would be nice if we could define intelligence in some other way than "that 
which gets the same meaning out of a sequence of symbols as we do". For if we can only 
define it this one way, then our argument that meaning is an intrinsic property is circular, 
hence content-free. We should try to formulate in some independent way a set of 
characteristics which deserve the name "intelligence". Such characteristics would 
constitute the uniform core of intelligence, shared by humans. At this point in history we 
do not yet have a well-defined list of those characteristics. However, it appears likely that 
within the next few decades there will be much progress made in elucidating what human 
intelligence is. In particular, perhaps cognitive psychologists, workers in Artificial 
Intelligence, and neuroscientists will be able to synthesize their understandings, and come 
up with a definition of intelligence. It may still be human-chauvinistic; there is no way 
around that. But to counterbalance that, there may be some elegant and beautiful-and 
perhaps even simple-abstract ways of characterizing the essence of intelligence. This 
would serve to lessen the feeling of having 

The Location of Meaning 


formulated an anthropocentric concept. And of course, if contact were established with an 
alien civilization from another star system, we feel supported in our belief that our own 
type of intelligence is not just a fluke, but an example of a basic form which reappears in 
nature in contexts, like stars and uranium nuclei. This in turn would support the idea of 
meaning being an inherent property. 

To conclude this topic, let us consider some new and old ex; and discuss the 
degree of inherent meaning which they have, by ourselves, to the extent that we can, in 
the shoes of an alien civilization which intercepts a weird object ... 

Two Plaques in Space 

Consider a rectangular plaque made of an indestructible metallic alloy which are 
engraved two dots, one immediately above the another preceding colon shows a picture. 
Though the overall form of the might suggest that it is an artifact, and therefore that it 
might conceal some message, two dots are simply not sufficient to convey anything. (Can 
before reading on, hypothesize what they are supposed to mean suppose that we made a 
second plaque, containing more dots, as follows. 

• • • 

Now one of the most obvious things to do-so it might seer terrestrial intelligence 
at least- would be to count the dots in the successive rows. The sequence obtained is: 

1, 1, 2, 3, 5, 8, 13, 21, 34. 

Here there is evidence of a rule governing the progression from one the next. In fact, the 
recursive part of the definition of the Fib numbers can be inferred, with some confidence, 
from this list. Supp think of the initial pair of values (1,1) as a "genotype" from which the 
"phenotype"-the full Fibonacci sequence-is pulled out by a recursive rule. By sending the 
genotype alone -namely the first version plaque-we fail to send the information which 
allows reconstitution phenotype. Thus, the genotype does not contain the full 
specification of 

The Location of Meaning 


the phenotype. On the other hand, if we consider the second version of the plaque to be 
the genotype, then there is much better cause to suppose that the phenotype could 
actually be reconstituted. This new version of the genotype-a "long genotype"-contains so 
much information that the mechanism by which phenotype is pulled out of genotype can 
be inferred by intelligence from the genotype alone. 

Once this mechanism is firmly established as the way to pull phenotype from 
genotype, then we can go back to using "short genotypes"-like the first plaque. For 
instance, the "short genotype" (1,3) would yield the phenotype 

1, 3, 4, 7, 11, 18, 29, 47,... 

-the Lucas sequence. And for every set of two initial values-that is, for every short 
genotype-there will be a corresponding phenotype. But the short genotypes, unlike the 
long ones, are only triggers-buttons to be pushed on the jukeboxes into which the 
recursive rule has been built. The long genotypes are informative enough that they 
trigger, in an intelligent being, the recognition of what kind of "jukebox" to build. In that 
sense, the long genotypes contain the information of the phenotype, whereas the short 
genotypes do not. In other words, the long genotype transmits not only an inner message, 
but also an outer message, which enables the inner message to be read. It seems that the 
clarity of the outer message resides in the sheer length of the message. This is not 
unexpected; it parallels precisely what happens in deciphering ancient texts. Clearly, 
one's likelihood of success depends crucially on the amount of text available. 

Bach vs. Cage Again 

But just having a long text may not be enough. Let us take up once more the difference 
between sending a record of Bach's music into space, and a record of John Cage's music. 
Incidentally, the latter, being a Composition of Aleatorically Generated Elements, might 
be handily called a "CAGE", whereas the former, being a Beautiful Aperiodic Crystal of 
Harmony, might aptly be dubbed a "BACH". Now let's consider what the meaning of a 
Cage piece is to ourselves. A Cage piece has to be taken in a large cultural setting-as a 
revolt against certain kinds of traditions. Thus, if we want to transmit that meaning, we 
must not only send the notes of the piece, but we must have earlier communicated an 
extensive history of Western culture. It is fair to say, then, that an isolated record of John 
Cage's music does not have an intrinsic meaning. However, for a listener who is 
sufficiently well versed in Western and Eastern cultures, particularly in the trends in 
Western music over the last few decades, it does carry meaning-but such a listener is like 
a jukebox, and the piece is like a pair of buttons. The meaning is mostly contained inside 
the listener to begin with; the music serves only to trigger it. And this "jukebox", unlike 
pure intelligence, is not at all universal; it is highly earthbound, depending on 
idiosyncratic se- 

The Location of Meaning 


quences of events all over our globe for long period of time. Hoping that John Cage's 
music will be understood by another civilization is like hoping that your favorite tune, on 
a jukebox on the moon, will have the same buttons as in a saloon in Saskatoon. 

On the other hand, to appreciate Bach requires far less cultural k edge. This may 
seem like high irony, for Bach is so much more con and organized, and Cage is so devoid 
of intellectuality. But there strange reversal here: intelligence loves patterns and balks at 
randomness For most people, the randomness in Cage's music requires much explanation; 
and even after explanations, they may feel they are missing the message-whereas with 
much of Bach, words are superfluous. In sense, Bach's music is more self-contained than 
Cage's music. Still, it is clear how much of the human condition is presumed by Bach. 

For instance, music has three major dimensions of structure (me harmony, 
rhythm), each of which can be further divided into small intermediate, and overall 
aspects. Now in each of these dimensions, there is a certain amount of complexity which 
our minds can handle before boggling; clearly a composer takes this into account, mostly 
unconsciously when writing a piece. These "levels of tolerable complexity" along 
different dimensions are probably very dependent on the peculiar conditions of our 
evolution as a species, and another intelligent species might have developed music with 
totally different levels of tolerable complexity along these many dimensions. Thus a Bach 
piece might conceivably have to be accompanied, by a lot of information about the 
human species, which simply could not inferred from the music's structure alone. If we 
equate the Bach music a genotype, and the emotions which it is supposed to evoke with 
the phenotype, then what we are interested in is whether the genotype con all the 
information necessary for the revelation of the phenotype. 

How Universal Is DNA's Message? 

The general question which we are facing, and which is very similar t questions inspired 
by the two plaques, is this: "How much of the co necessary for its own understanding is a 
message capable of restoring? can now revert to the original biological meanings of 
"genotype" "phenotype" -DNA and a living organism-and ask similar quest Does DNA 
have universal triggering power? Or does it need a "biojukebox" to reveal its meaning? 
Can DNA evoke a phenotype without being embedded in the proper chemical context? 
To this question to answer is no-but a qualified no. Certainly a molecule of DNA in a 
vacuum will not create anything at all. However, if a molecule of DNA were set to seek 
its fortune in the universe, as we imagined the BACH and the CAGE were, it might be 
intercepted by an intelligent civilization. They might first of all recognize its frame 
message. Given that, they might to try to deduce from its chemical structure what kind of 
chemical environment it seemed to want, and then supply such an environment. Succes- 

The Location of Meaning 


sively more refined attempts along these lines might eventually lead to a full restoration 
of the chemical context necessary for the revelation of DNA's phenotypical meaning. 
This may sound a little implausible, but if one allows many millions of years for the 
experiment, perhaps the DNA's meaning would finally emerge. 

On the other hand, if the sequence of bases which compose a strand of DNA were 
sent as abstract symbols (as in Fig. 41), not as a long helical molecule, the odds are 
virtually nil that this, as an outer message, would trigger the proper decoding mechanism 
which would enable the phenotype to be drawn out of the genotype. This would be a case 
of wrapping an inner message in such an abstract outer message that the context-restoring 
power of the outer message would be lost, and so in a very pragmatic sense, the set of 
symbols would have no intrinsic meaning. Lest you think this all sounds hopelessly 
abstract and philosophical, consider that the exact moment when phenotype can be said to 
be "available", or "implied", by genotype, is a highly charged issue in our day: it is the 
issue of abortion. 

FIGURE 41. This Giant Aperiodic Crystal is the base sequence for the chromosome of 
bacteriophage 0X1 74. It is the first complete genome ever mapped out for any organism. 
About 2,000 of these boustrophedonic pages would be needed to show the base sequence 
of a single E. Coli cell, and about one million pages to show the base sequence of the 
DNA of a single human cell. The book now in your hands contains roughly the same 
amount of information as a molecular blueprint for one measly E. Coli cell. 

c cgt cacgaitc acaccgtcc c aaitgtat gttttcatgcctcc aaat cttggacccttttttatggtt cgtt cttatt acc cttctcaatgtcacgctg \ 






t nn r c c c cc aagg agtt actt acccttccgaa gttgttcc act attcgt c ctctttg tatgct tccg c gtattg ci atgg tg actgcg act cgttag aat* 


r re ere gtttgt atttactgg agtg aatt cacc gacctctcttt att ag ag aaa tt attgg act aagtcgctttggttaggc gccgtaaatca tcgcc att* 



The Location of Meaning 


Chromatic Fantasy, And Feud. 

Having had a splendid dip in the pond, the Tortoise is just crawling out and 
shaking himself dry, when who but Achilles walks by. 

Tortoise: Ho there, Achilles. I was just thinking of you as I splash around in the pond. 

Achilles: Isn't that curious? I was just thinking of you, too, while I meandered through the 
meadows. They're so green at this time of year. 

Tortoise: You think so? It reminds me of a thought I was hoping to share with you. 
Would you like to hear it? 

Achilles: Oh, I would be delighted. That is, I would be delighted as long you're not going 
to try to snare me in one of your wicked traps of log Mr. T. 

Tortoise: Wicked traps? Oh, you do me wrong. Would I do anything wicked? I'm a 
peaceful soul, bothering nobody and leading a gent; herbivorous life. And my 
thoughts merely drift among the oddities and quirks of how things are (as I see 
them). I, humble observer phenomena, plod along and puff my silly words into 
the air rather unspectacularly, I am afraid. But to reassure you about my intention 
I was only planning to speak of my Tortoise-shell today, and as you know, those 
things have nothing-nothing whatsoever-to do with logic! 

Achilles: Your words Do reassure me, Mr. T. And, in fact, my curiosity quite piqued. I 
would certainly like to listen to what you have to say even if it is unspectacular. 

Tortoise: Let's see ... how shall I begin? Hmm ... What strikes you me about my shell, 

Achilles: It looks wonderfully clean! 

Tortoise: Thank you. I just went swimming and washed off several layers of dirt which 
had accumulated last century. Now you can see ho green my shell is. 

Achilles: Such a good healthy green shell, it's nice to see it shining in sun. 

Tortoise: Green? It's not green. 

Achilles: Well, didn't you just tell me Tortoise: I did. 

Achilles: Then, we agree: it is green. Tortoise: No, it isn't green. 

Achilles: Oh, I understand your game. You're hinting to me that what you say isn't 
necessarily true; that Tortoises play with language; that your statements and 
reality don't necessarily match; that — 

Tortoise: I certainly am not. Tortoises treat words as sacred. Tortoises revere accuracy. 
Achilles: Well, then, why did you say that your shell is green, and that it is not green 

Tortoise: I never said such a thing; but I wish I had. Achilles: You would have liked to 
say that? 

Tortoise: Not a bit. I regret saying it, and disagree wholeheartedly with it. Achilles: That 
certainly contradicts what you said before! 

Tortoise: Contradicts? Contradicts? I never contradict myself. It's not part of Tortoise- 

Achilles: Well, I've caught you this time, you slippery fellow, you. Caught you in a full- 
fledged contradiction. 
Tortoise: Yes, I guess you did. 

Achilles: There you go again! Now you're contradicting yourself more and more! You are 

so steeped in contradiction it's impossible to argue with you! 
Tortoise: Not really. I argue with myself without any trouble at all. Perhaps the problem 

is with you. I would venture a guess that maybe you're the one who's 

contradictory, but you're so trapped in your own tangled web that you can't see 

how inconsistent you're being. 
Achilles: What an insulting suggestion! I'm going to show you that you're the 

contradictory one, and there are no two ways about it. 
Tortoise: Well, if it's so, your task ought to be cut out for you. What could be easier than 

to point out a contradiction? Go ahead-try it out. 
Achilles: Hmm ... Now I hardly know where to begin. Oh ... I know. You first said that 

(1) your shell is green, and then you went on to say that (2) your shell is not 

green. What more can I say? 
Tortoise: Just kindly point out the contradiction. Quit beating around the bush. 
Achilles: But-but-but ... Oh, now I begin to see. (Sometimes I am so slow-witted!) It must 

be that you and I differ as to what constitutes a contradiction. That's the trouble. 

Well, let me make myself very clear: a contradiction occurs when somebody says 

one thing and denies it at the same time. 
Tortoise: A neat trick. I'd like to see it done. Probably ventriloquists would excel at 

contradictions, speaking out of both sides of their mouth, as it were. But I'm not a 


Achilles: Well, what I actually meant is just that somebody can say one thing and deny it 

all within one single sentence! It doesn't literally have to be in the same instant. 
Tortoise: Well, you didn't give ONE sentence. You gave TWO. 
Achilles: Yes-two sentences that contradict each other! 

Tortoise: I am sad to see the tangled structure of your thoughts becoming so exposed, 
Achilles. First you told me that a contradiction is some thing which occurs in a 
single sentence. Then you told me that you 

Found a contradiction in a pair of sentences I uttered. Frankly, it's just as I said. Your 

own system of thought is so delusional that you manage to avoid seeing how 

inconsistent it is. From the outside, however plain as day. 
Achilles: Sometimes I get so confused by your diversionary tactics tl can't quite tell if 

we're arguing about something utterly petty, or something deep and profound! 
Tortoise: I assure you, Tortoises don't spend their time on the petty. Hence it's the latter. 
Achilles: I am very reassured. Thank you. Now I have had a moment to reflect, and I see 

the necessary logical step to convince you that you contradicted yourself. 
Tortoise: Good, good. I hope it's an easy step, an indisputable one. 
Achilles: It certainly is. Even you will agree with it. The idea is that you believed 

sentence 1 ("My shell is green"), AND you believed sentence 2 ("My shell is not 

green"), you would believe one compound( sentence in which both were 

combined, wouldn't you? 
Tortoise: Of course. It would only be reasonable ... providing just that the manner of 

combination is universally acceptable. But I'm sure we'll agree on that. 
Achilles: Yes, and then I'll have you! The combination I propose is 
Tortoise: But we must be careful in combining sentences. For instance you'd grant that 

"Politicians lie" is true, wouldn't you? 
Achilles: Who could deny it? 

Tortoise: Good. Likewise, "Cast-iron sinks" is a valid utterance, isn't it? 
Achilles: Indubitably. 

Tortoise: Then, putting them together, we get "Politicians lie in cast iron sinks". Now 

that's not the case, is it? 
Achilles: Now wait a minute ... "Politicians lie in cast-iron sinks?" N no, but 
Tortoise: So, you see, combining two true sentences in one is not a policy, is it? 
Achilles: But you-you combined the two-in such a silly way! 

Tortoise: Silly? What have you got to object to in the way I combined them Would you 
have me do otherwise? 

Achilles: You should have used the word "and", not "in". 

Tortoise: I should have? You mean, if YOU'D had YOUR way, I should h; 

Achilles: No-it's the LOGICAL thing to do. It's got nothing to do with personally. 

Tortoise: This is where you always lose me, when you resort to your L and its high- 
sounding Principles. None of that for me today, plea 

Achilles: Oh, Mr. Tortoise, don't put me through all this agony. You k very well that 
that's what "and" means! It's harmless to combine true sentences with "and"! 

Tortoise: "Harmless", my eye! What gall! This is certainly a pernicious plot 

to entrap a poor, innocent, bumbling Tortoise in a fatal contradiction. If it were so 
harmless, why would you be trying so bloody hard to get me to do it? Eh? 

Achilles: You've left me speechless. You make me feel like a villain, where I really had 
only the most innocent of motivations. 

Tortoise: That's what everyone believes of himself... 

Achilles: Shame on me-trying to outwit you, to use words to snare you in a self- 
contradiction. I feel so rotten. 

Tortoise: And well you should. I know what you were trying to set up. Your plan was to 
make me accept sentence 3, to wit: "My shell is green and my shell is not green". 
And such a blatant falsehood is repellent to the Tongue of a Tortoise. 

Achilles: Oh, I'm so sorry I started all this. 

Tortoise: You needn't be sorry. My feelings aren't hurt. After all, I'm used to the 

unreasonable ways of the folk about me. I enjoy your company, Achilles, even if 

your thinking lacks clarity. 
Achilles: Yes ... Well, I fear I am set in my ways, and will probably continue to err and 

err again, in my quest for Truth. 
Tortoise: Today's exchange may have served a little to right your course. Good day, 

Achilles: Good day, Mr. T. 

The Propositional Calculus 

Words and Symbols 

THE PRECEDING DIALOGUE is reminiscent of the Two-Part Invention by Lewis 
Carroll. In both, the Tortoise refuses to use normal, ordinary in the normal, ordinary way- 
or at least he refuses to do so when it is his advantage to do so. A way to think about the 
Carroll paradox was given last Chapter. In this Chapter we are going to make symbols dc 
Achilles couldn't make the Tortoise do with his words. That is, we are to make a formal 
system one of whose symbols will do just what A wished the word 'and' would do, when 
spoken by the Tortoise, and ail of whose symbols will behave the way the words 'if... then 
. . .' ought to behave. There are only two other words which we will attempt to deal with 
'or' and not'. Reasoning which depends only on correct usage of these words is termed 
propositional reasoning. 

Alphabet and First Rule of the Propositional Calculus 

I will present this new formal system, called the Propositional Calculus, like a puzzle, not 
explaining everything at once, but letting you things out to some extent. We begin with 
the list of symbols: 

< > 
P Q R ' 

A V Z) ~ 

The first rule of this system that I will reveal is the following: 

RULE OF JOINING: If x and y are theorems of the system, then so is the string < xAy >. 

This rule takes two theorems and combines them into one. It s remind you of the 

Well-Formed Strings 

There will be several other rules of inference, and they will all be pres shortly-but first, it 
is important to define a subset of all strings, namely the 

The Propositional Calculus 


well formed strings. They will be defined in a recursive way. We begin with the 
ATOMS: P, Q, and R are called atoms.. New atoms are formed by appending primes 
onto the right of old atoms-thus, R', Q", P'", etc. This gives an endless supply of atoms. 
All atoms are well-formed. 

Then we have four recursive 

FORMATION RULES: If x and y are well-formed, then the following four strings are 
also well-formed: 

(1) ~x 

(2) < xAy> 

(3) < xvy> 

(4) < xz>y> 

For example, all of the following are well-formed: 










<Pa~Q* > 

by (2) 

~<Pa~Q' > 


— <Pd~Q' > 

by (4) 

<~<Pa~Q' >v~~<Y=>~Q' » 

by (3) 

The last one may look quite formidable, but it is built up straightforwardly from two 
components-namely the two lines just above it. Each of them is in turn built up from 
previous lines ... and so on. Every well-formed string can in this way be traced back to its 
elementary constituents-that is, atoms. You simply run the formation rules backwards 
until you can no more. This process is guaranteed to terminate, since each formation rule 
(when run forwards) is a lengthening rule, so that running it backwards always drives you 
towards atoms. 

This method of decomposing strings thus serves as a check on the well- 
formedness of any string. It is a top-down decision procedure for wellformedness. You 
can test your understanding of this decision procedure by checking which of the 
following strings are well-formed: 

(1) <P> 

(2) (2) <~P> 

(3) <PaQaR> 

(4) <PaQ> 

(5) «PaQ>aQ~aP» 

(6) <Pa~P> 

(7) «Pv<Q3R»a<~Pv~R'» 

(8) <PaQ>a< QaP: 

The Propositional Calculus 


(Answer: Those whose numbers are Fibonacci numbers are not formed. The rest are well- 

More Rules of Inference 

Now we come to the rest of the rules by which theorems of this system constructed. A 
few rules of inference follow. In all of them, the symbols V and 'y' are always to be 
understood as restricted to well formed strings 

RULE OF SEPARATION: If < xAy> is a theorem, then both x and theorems. 

Incidentally, you should have a pretty good guess by now as to concept the symbol "A 
stands for. (Hint: it is the troublesome word the preceding Dialogue.) From the following 
rule, you should be a figure out what concept the tilde ('-') represents: 

DOUBLE-TILDE RULE: The string ' — ' can be deleted from any theorem. It can also be 
inserted into any theorem, provided that the rest string is itself well-formed. 

The Fantasy Rule 

Now a special feature of this system is that it has no axioms-only rule you think back to 
the previous formal systems we've seen, you may w( how there can be any theorems, 
then. How does everything get started? The answer is that there is one rule which 
manufactures theorems from out of thin air- it doesn't need an "old theorem" as input. 
(The rest of the do require input.) This special rule is called the fantasy rule. The reason I 
call it that is quite simple. 

To use the fantasy rule, the first thing you do is to write down an well-formed 
string x you like, and then "fantasize" by asking, "What if string x were an axiom, or a 
theorem?" And then, you let the system give an answer. That is, you go ahead and make a 
derivation with x ; opening line; let us suppose y is the last line. (Of course the derivation 
must strictly follow the rules of the system.) Everything from x to y (inclusive) is the 
fantasy; x is the premise of the fantasy, and y is its outcome. The next step is to jump out 
of the fantasy, having learned from it that out. 

If x were a theorem, y would be a theorem. 

Still, you might wonder, where is the real theorem? The real theorem is the string 


Notice the resemblance of this string to the sentence printed above 

To signal the entry into, and emergence from, a fantasy, one uses the 

The Propositional Calculus 


square brackets and ']', respectively. Thus, whenever you see a left square bracket, you 
know you are "pushing" into a fantasy, and the next line will contain the fantasy's 
premise. Whenever you see a right square bracket, you know you are "popping" back out, 
and the preceding line was the outcome. It is helpful (though not necessary) to indent 
those lines of a derivation which take place in fantasies. 

Here is an illustration of the fantasy rule, in which the string P is taken as a 
premise. (It so happens that P is not a theorem, but that is of no import; we are merely 
inquiring, "What if it were?") We make the following fantasy: 

[ push into fantasy 

P premise 

~~~P outcome (by double tilde rule) 

] pop out of fantasy 

The fantasy shows that: 

If P were a theorem, so would ~~P be one. 

We now "squeeze" this sentence of English (the metalanguage) into the formal 
notation (the object language): <P3 — P>. This, our first theorem of the Propositional 
Calculus, should reveal to you the intended interpretation of the symbol "z/. 

Here is another derivation using the fantasy rule: 

[ push 

<PaQ> premise 

P separation 

Q separation 

<QaP> joining 

] POP 

«PaQ>z><QaP» fantasy rule 

It is important to understand that only the last line is a genuine theorem, here-everything 
else is in the fantasy. 

Recursion and the Fantasy Rule 

As you might guess from the recursion terminology "push" and "pop", the fantasy rule 
can be used recursively-thus, there can be fantasies within fantasies, thrice-nested 
fantasies, and so on. This means that there are all sorts of "levels of reality", just as in 
nested stories or movies. When you pop out of a movie-within-a-movie, you feel for a 
moment as if you had reached the real world, though you are still one level away from the 
top. Similarly, when you pop out of a fantasy-within-a-fantasy, you are in a "realer" 
world than you had been, but you are still one level away from the top. 

Now a "No Smoking" sign inside a movie theater does not apply to the 

The Propositional Calculus 


characters in the movie-there is no carry-over from the real world in fantasy world, in 
movies. But in the Propositional Calculus, then carry-over from the real world into the 
fantasies; there is even carry from a fantasy to fantasies inside it. This is formalized by 
the following rule: 

CARRY-OVER RULE: Inside a fantasy, any theorem from the "reality level higher can 
be brought in and used. 

It is as if a "No Smoking" sign in a theater applied not only to a moviegoers, but also to 
all the actors in the movie, and, by repetition of the same idea, to anyone inside multiply 
nested movies! (Warning: There carry-over in the reverse direction: theorems inside 
fantasies cannot be exported to the exterior! If it weren't for this fact, you could write any 
as the first line of a fantasy, and then lift it out into the real world as a theorem.) 

To show how carry-over works, and to show how the fantasy rule can be used 
recursively, we present the following derivation: 

[ push 

P premise of outer fantasy 

[ push again 

Q premise of inner fantasy 

P carry-over of P into inner fantasy 

<PaQ> joining 

] pop out of inner fantasy, regain outer fantasy 

<Q=><PaQ» fantasy rule 

] pop out of outer fantasy, reach real world! 

<Pz><Qz><PaQ»> fantasy rule 

Note that I've indented the outer fantasy once, and the inner fantasy twice, to 
emphasize the nature of these nested "levels of reality". One to look at the fantasy rule is 
to say that an observation made about the system is inserted into the system. Namely, the 
theorem < xz>y> which gets produced can be thought of as a representation inside the 
system of the statement about the system "If x is a theorem, then y is too". To be specific, 
the intended interpretation for <Pz>Q> is "if P, then Q equivalently, "P implies Q". 

The Converse of the Fantasy Rule 

Now Lewis Carroll's Dialogue was all about "if-then" statements. In particular, Achilles 
had a lot of trouble in persuading the Tortoise to accept the second clause of an "if-then" 
statement, even when the "if-then" state itself was accepted, as well as its first clause. The 
next rule allows y infer the second "clause" of a'zj'-string, provided that the ^'-string it a 
theorem, and that its first "clause" is also a theorem. 

The Propositional Calculus 


RULE OF DETACHMENT: If x and < xz>y> are both theorems, then y is a theorem. 

Incidentally, this rule is often called "Modus Ponens", and the fantasy rule is often called 
the "Deduction Theorem". 

The Intended Interpretation of the Symbols 

We might as well let the cat out of the bag at this point, and reveal the "meanings" of the 
rest of the symbols of our new system. In case it is not yet apparent, the symbol 'A' is 
meant to be acting isomorphically to the normal, everyday word 'and. The symbol '-' 
represents the word 'not'-it is a formal sort of negation. The angle brackets '<' and ">' are 
groupers-their function being very similar to that of parentheses in ordinary algebra. The 
main difference is that in algebra, you have the freedom to insert parentheses or to leave 
them out, according to taste and style, whereas in a formal system, such anarchic freedom 
is not tolerated. The symbol V represents the word "or' ('vel' is a Latin word for "or'). The 
"or' that is meant is the so-called inclusive "or', which means that the interpretation of 
<xvy> is "either x or y-or both". 

The only symbols we have not interpreted are the atoms. An atom has no single 
interpretation-it may be interpreted by any sentence of English (it must continue to be 
interpreted by the same sentence if it occurs multiply within a string or derivation). Thus, 
for example, the well-formed string <Pa~P> could be interpreted by the compound 

This mind is Buddha, and this mind is not Buddha. 

Now let us look at each of the theorems so far derived, and interpret them. The first one 
was <Pz>~~P>. If we keep the same interpretation for P, we have the following 

If this mind is Buddha, 

then it is not the case that this mind is not Buddha. 

Note how I rendered the double negation. It is awkward to repeat a negation in any 
natural language, so one gets around it by using two different ways of expressing 
negation. The second theorem we derived was «PaQ>zkQaP». If we let Q be 
interpreted by the sentence "This flax weighs three pounds", then our theorem reads as 

If this mind is Buddha and this flax weighs three pounds, 

then this flax weighs three pounds and this mind is Buddha. 

The third theorem was <P:d<Qz><PaQ»>. This one goes into the following nested "if- 
then" sentence: 

The Propositional Calculus 


If this mind is Buddha, 

then, if this flax weighs three pounds, 

then this mind is Buddha and this flax weighs three pounds. 

You probably have noticed that each theorem, when interpreted, something 
absolutely trivial and self-evident. (Sometimes they are so s evident that they sound 
vacuous and-paradoxically enough-confusing or even wrong!) This may not be very 
impressive, but just remember there are plenty of falsities out there which could have 
been produced they weren't. This system-the Propositional Calculus-steps neatly ft truth 
to truth, carefully avoiding all falsities, just as a person who is concerned with staying dry 
will step carefully from one stepping-stone creek to the next, following the layout of 
stepping-stones no matter I twisted and tricky it might be. What is impressive is that-in 
the Propositional Calculus-the whole thing is done purely typographically. There is 
nobody down "in there", thinking about the meaning of the strings. It i! done 
mechanically, thoughtlessly, rigidly, even stupidly. 

Rounding Out the List of Rules 

We have not yet stated all the rules of the Propositional Calculus. The complete set of 
rules is listed below, including the three new ones. 

JOINING RULE: If x and y are theorems, then < xAy> is a theorem. 

SEPARATION RULE: If < xAy> is a theorem, then both x and y are theorems. 

DOUBLE-TILDE RULE: The string ' — ' can be deleted from any theorem can also be 
inserted into any theorem, provided that the result string is itself well-formed. 

FANTASY RULE: If y can be derived when x is assumed to be a theorem then < xz>y> is 
a theorem. 

CARRY-OVER RULE: Inside a fantasy, any theorem from the "reality" c level higher 
can be brought in and used. 

RULE OF DETACHMENT: If x and < x^y> are both theorems, then y is a theorem. 

CONTRAPOSITIVE RULE: <xuy> and <~yzD~x> are interchangeable 

DE MORGAN'S RULE: <~xA~y> and ~< xvy> are interchangeable. 

SWITCHEROO RULE: <xvy> and <~xzjy> are interchangeable. 

(The Switcheroo rule is named after Q. q. Switcheroo, an Albanian railroad engineer who 
worked in logic on the siding.) By "interchangeable" in foregoing rules, the following is 
meant: If an expression of one form occurs as either a theorem or part of a theorem, the 
other form may be 

The Propositional Calculus 


substituted, and the resulting string will also be a theorem. It must be kept in mind that 
the symbols 'x' and 'y' always stand for well-formed strings of the system. 

Before we see these rules used inside derivations, let us look at some very short 
justifications for them. You can probably justify them to yourself better than my 
examples - which is why I only give a couple. 

The contrapositive rule expresses explicitly a way of turning around conditional 
statements which we carry out unconsciously. For instance, the "Zentence" 

If you are studying it, then you are far from the Way 

Means the same thing as 

If you are close to the Way, then you are not studying it. 

De Morgan's rule can be illustrated by our familiar sentence "The flag is not 
moving and the wind is not moving". If P symbolizes "the flag is not moving", and Q 
symbolizes "the wind is moving", then the compound sentence is symbolized by 
<~Pa~Q>, which, according to Morgan's law, is interchangeable with ~<PvQ>. whose 
interpretation would be "It is not true that either the flag or the wind is moving". And no 
one could deny that it is a Zensible conclusion to draw. 

For the Switrcheroo rule, consider the sentence "Either a cloud is hanging over 
the mountain, or the moonlight is penetrating the waves of the lake," which might be 
spoken, I suppose, by a wistful Zen master remembering a familiar lake which he can 
visualize mentally but cannot see. Now hang on to your seat, for the Swircheroo rule tells 
us that this is interchangeable with the thought "If a cloud is not hanging over the 
mountain, then the moonlight is penetrating the waves of the lake." This may not be 
enlightenment, but it is the best the Propositional Calculus has to offer. 

Now, let us apply these rules to a previous theorem, ands see what we get: For instance, 
take the theorem <Pz> — P>: 

Justifying the Rules 

Playing around with the system 

<Pz>~~ P>: 

old theorem 



This new theorem, when interpreted, says: 

The Propositional Calculus 


Either this mind is Buddha, or this mind is not Buddha 

Once again, the interpreted theorem, though perhaps less than mind boggling, is at least 

It is natural, when one reads theorems of the Propositional Calculus out loud, to interpret 
everything but the atoms. I call this semi-interpreting. For example, the semi- 
interpretation of <Pv~P>:: would be 

Despite the fact that P is not a sentence, the above semisentence still sounds true, because 
you can very easily imagine sticking any sentence in for P - and the form of the semi- 
interpreted theorem assures you that however you make your choice, the resulting 
sentence will be true. And that is the key idea of the Propositional Calculus: it produces 
theorems which, when semi-interpreted, are seen to be "universally true semisaentences", 
by which is meant that no matter how you complete the interpretation, the final result will 
be a true statement. 

Now we can do a more advanced exercise, based on a Zen koan called "Ganto's Ax". 
Here is how it began. 

One day Tokusan told his student Ganto, "I have two monks who have been here 
for many years. Go and examine them." Ganto picked up an ax and went to the hut 
where the two monks were meditating. He raised the ax, saying "If you say a word, 
I will cut off your heads; and if you do not say a word, I will also cut off your 
heads." 1 

If you say a word I will cut off this koan, and if you do not say a word, I will also cut off 
this koan - because I want you to translate some of it into our notation. Let us symbolize 
"you say a word" by P and "I will cut off your heads" by Q. Then Ganto's ax threat is 
symbolized by the string «Pz)Q>a<~'Pz>Q». What if this ax threat were an axiom? 
Here is a fantasy to answer that question. 


P or not P. 

Ganto's Ax 

(1) [ 

(2) «P3Q>a<~T3Q». 

(3) <P=dQ> 

(4) <~Q3~P>. 

(5) <~P^Q> 

(6) <~Q3~~ P>. 

(V) ] 

(8) ~Q 


Ganto's axiom 





push again 


The Propositional Calculus 




carry-over of line 4 





<~Q3~~ P>. 

carry-over of line 6 



detachment (lines 8 and 11) 





<~p v ~~P> 

De Morgan 



pop once 



fantasy rule 









premise (also outcome) 






fantasy rule 






detachment (lines 22 and 17) 



pop out 

The power of the Propositional Calculus is shown in this example. Why, in but two dozen 
steps, we have deduced Q: that the heads will be cut off! (Ominously, the rule last 
invoked was "detachment" ...) It might seem superfluous to continue the koan now, since 
we know what must ensue ... However, I shall drop my resolve to cut the koan off; it is a 
true Zen koan, after all. The rest of the incident is here related: 

Both monks continued their meditation as if he had not spoken. Ganto dropped the 
ax and said, "You are true Zen students." He returned to Tokusan and related the 
incident. "I see your side well," Tokusan agreed, "but tell me, how is their side?" 
"Tozan may admit them," replied Ganto, "but they should not be admitted under 
Tokusan. "2 

Do you see my side well? How is the Zen side? 

Is There a Decision Procedure for Theorems? 

The Propositional Calculus gives us a set of rules for producing statements which would 
be true in all conceivable worlds. That is why all of its theorems sound so simple-minded; 
it seems that they have absolutely no content! Looked at this way, the Propositional 
Calculus might seem to be a waste of time, since what it tells us is absolutely trivial. On 
the other hand, it does it by specifying the form of statements that are universally true, 
and this throws a new kind of light onto the core truths of the universe: they are not only 
fundamental, but also regular, they can be produced by one set of typographical rules. To 
put it another way, they are all "cut from the same cloth". You might consider whether 
the same could be said about Zen koans: could they all be produced by one set of 
typographical rules? 

It is quite relevant here to bring up the question of a decision procedure. That is, 
does there exist any mechanical method to tell nontheorems from theorems? If so, that 
would tell us that the set of theorems of the 

The Propositional Calculus 


Propositional Calculus is not only r.e., but also recursive. It turns out that there is an 
interesting decision procedure-the method of truth u would take us a bit afield to present 
it here; you can find it in almost any standard book on logic. And what about Zen koans? 
Could there conceivably be a mechanical decision procedure which distinguishes genuine 
Zen koans from other things? 

Do We Know the System Is Consistent? 

Up till now, we have only presumed that all theorems, when interpreted as indicated, are 
true statements. But do we know that that is the case' we prove it to be? This is just 
another way of asking whether the intended interpretations ('and' for 'a', etc.) merit being 
called the "passive meanings" of the symbols. One can look at this issue from two very 
different points of view, which might be called the "prudent" and "imprudent" points I 
will now present those two sides as I see them, personifying their as "Prudence" and 

Prudence: We will only KNOW that all theorems come out true un intended 
interpretation if we manage to PROVE it. That is the c: thoughtful way to proceed. 

Imprudence: On the contrary. It is OBVIOUS that all theorems will come out true. If you 
doubt me, look again at the rules of the system. You will find that each rule makes a 
symbol act exactly as the word it represents ought to be used. For instance, the joining 
rule makes the symbol 'a' act as 'and' ought to act; the rule of detachment makes "z>' 
act as it ought to, if it is to stand for 'implies', or 'if-then'; and so on. Unless you are 
like the Tortoise, you will recognize in each rule a codification of a pattern you use in 
your own thought patterns. So if you trust your own thought patterns, then you HAVE 
to believe that all theorems come out true! That's the way I see it. I don't need any 
further proof. If you think that some theorem comes out false, then presumably you 
think that some rule must be wrong. Show me which one. 

Prudence: I'm not sure that there is any faulty rule, so I can't point one out to you. Still, I 
can imagine the following kind of scenario. You, following the rules, come up with a 
theorem — say x. Meanwhile I, also following the rules, come up with another 
theorem-it happens to be ~x. Can't you force yourself to conceive of that? 

Imprudence: All right; let's suppose it happened. Why would it bother you? Or let me put 
it another way. Suppose that in playing with the MlU-system, I came up with a 
theorem x, and you came up with xU Can you force yourself to conceive of that? 

Prudence: Of course-in fact both MI and MIU are theorems. 

Imprudence: Doesn't that bother you? 

Prudence: Of course not. Your example is ridiculous, because MI and MIU are not 
CONTRADICTORY, whereas two strings x and ~x in the Propositional Calculus 
ARE contradictory. 

The Propositional Calculus 


Imprudence: Well, yes — provided you wish to interpret , ~' as not'. But what would lead 

you to think that '-' should be interpreted as not'? 
Prudence: The rules themselves. When you look at them, you realize that the only 

conceivable interpretation for '-' is 'not'-and likewise, the only conceivable 

interpretation for "a' is "and, etc. 
Imprudence: In other words, you are convinced that the rules capture the meanings of 

those words? 
Prudence: Precisely. 

Imprudence: And yet you are still willing to entertain the thought that both x and ~x 
could be theorems? Why not also entertain the notion that hedgehogs are frogs, or that 
1 equals 2, or that the moon is made of green cheese? I for one am not prepared even 
to consider whether such basic ingredients of my thought processes are wrong — 
because if I entertained that notion, then I would also have to consider whether my 
modes of analyzing the entire question are also wrong, and I would wind up in a total 

Prudence: Your arguments are forceful ... Yet I would still like to see a PROOF that all 
theorems come out true, or that x and ~x can never both be theorems. 

Imprudence: You want a proof. I guess that means that you want to be more convinced 
that the Propositional Calculus is consistent than you are convinced of your own 
sanity. Any proof I could think of would involve mental operations of a greater 
complexity than anything in the Propositional Calculus itself. So what would it prove? 
Your desire for a proof of consistency of the Propositional Calculus makes me think 
of someone who is learning English and insists on being given a dictionary which 
definers all the simple words in terms of complicated ones... 

The Carroll Dialogue Again 

This little debate shows the difficulty of trying to use logic and reasoning to defend 
themselves. At some point, you reach rock bottom, and there is no defense except loudly 
shouting, "I know I'm right!" Once again, we are up against the issue which Lewis 
Carroll so sharply set forth in his Dialogue: you can't go on defending your patterns of 
reasoning forever. There comes a point where faith takes over. 

A system of reasoning can be compared to an egg. An egg has a shell which 
protects its insides. If you want to ship an egg somewhere, though, you don't rely on the 
shell. You pack the egg in some sort of container, chosen according to how rough you 
expect the egg's voyage to be. To be extra careful, you may put the egg inside several 
nested boxes. However, no matter how many layers of boxes you pack your egg in, you 
can imagine some cataclysm which could break the egg. But that doesn't mean that you'll 
never risk transporting your egg. Similarly, one can never give an ultimate, absolute 
proof that a proof in some system is correct. Of course, 

The Propositional Calculus 


one can give a proof of a proof, or a proof of a proof of a proof - but the validity of the 
outermost system always remains an unproven assumption, accepted on faith. One can 
always imagine that some unsuspected subtlety will invalidate every single level of proof 
down to the bottom, and tl "proven" result will be seen not to be correct after all. But that 
doesn't mean that mathematicians and logicians are constantly worrying that the whole 
edifice of mathematics might be wrong. On the other hand, unorthodox proofs are 
proposed, or extremely lengthy proofs, or proofs generated by computers, then people do 
stop to think a bit about what they really mean by that quasi-sacred word "proven". 

An excellent exercise for you at this point would be to go back Carroll Dialogue, 
and code the various stages of the debate into our notation -- beginning with the original 
bone of contention: 

Achilles: If you have «AaB>z>Z>, and you also have <AaB>, then surely you have Z. 
Tortoise: Oh! You mean: ««AaB>=3Z>a<AaB»=dZ>, : don't you? 

(Hint: Whatever Achilles considers a rule of inference, the Tortoise immediately flattens 
into a mere string of the system. If you use or letters A, B, and Z, you will get a recursive 
pattern of longer and strings.) 

Shortcuts and Derived Rules 

When carrying out derivations in the Propositional Calculus, one quickly invents various 
types of shortcut, which are not strictly part of the system For instance, if the string 
<Qv~Q> were needed at some point, and <Pv~P> had been derived earlier, many people 
would proceed as if <Qv~Q> had been derived, since they know that its derivation is an 
exact parallel to that of <Pv~P>. The derived theorem is treated as a "theorem schema" — 
a mold for other theorems. This turns out to be a perfect valid procedure, in that it always 
leads you to new theorems, but it is not a rule of the Propositional Calculus as we 
presented it. It is, rather, a derived rule, It is part of the knowledge which we have about 
the system. That this rule keeps you within the space of theorems needs proof, of course- 
but such a proof is not like a derivation inside the system. It is a proof in the ordinary, 
intuitive sense — a chain of reasoning carried out in the I-mode. The theory about the 
Propositional Calculus is a "metatheory", and results in it can be called "metatheorems" - 
Theorems about theorems. (Incidentally, note the peculiar capitalization in the phrase 
"Theorems about theorems". It is a consequence of our convention: metatheorems are 
Theorems (proven results) concerning theorems (derivable strings).) 

In the Propositional Calculus, one could discover many metatheorems, or derived 
rules of inference. For instance, there is a De Morgan's Rule: 

The Propositional Calculus 


<~xv~y> and ~<xAy> are interchangeable. 

If this were a rule of the system, it could speed up many derivations considerably. But if 
we prove that it is correct, isn't that good enough? Can't we use it just like a rule of 
inference, from then on? 

There is no reason to doubt the correctness of this particular derived rule. But 
once you start admitting derived rules as part of your procedure in the Propositional 
Calculus, you have lost the formality of the system, since derived rules are derived 
informally-outside the system. Now formal systems were proposed as a way to exhibit 
every step of a proof explicitly, within one single, rigid framework, so that any 
mathematician could check another's work mechanically. But if you are willing to step 
outside of that framework at the drop of a hat, you might as well never have created it at 
all. Therefore, there is a drawback to using such shortcuts. 

Formalizing Higher Levels 

On the other hand, there is an alternative way out. Why not formalize the metatheory, 
too? That way, derived rules (metatheorems) would be theorems of a larger formal 
system, and it would be legitimate to look for shortcuts and derive them as theorems-that 
is, theorems of the formalized metatheory-which could then be used to speed up the 
derivations of theorems of the Propositional Calculus. This is an interesting idea, but as 
soon as it is suggested, one jumps ahead to think of metametatheories, and so on. It is 
clear that no matter how many levels you formalize, someone will eventually want to 
make shortcuts in the top level. 

It might even be suggested that a theory of reasoning could be identical to its own 
metatheory, if it were worked out carefully. Then, it might seem, all levels would 
collapse into one, and thinking about the system would be just one way of working in the 
system! But it is not that easy. Even if a system can "think about itself, it still is not 
outside itself. You, outside the system, perceive it differently from the way it perceives 
itself. So there still is a metatheory-a view from outside-even for a theory which can 
"think about itself inside itself. We will find that there are theories which can "think 
about themselves". In fact, we will soon see a system in which this happens completely 
accidentally, without our even intending it! And we will see what kinds of effects this 
produces. But for our study of the Propositional Calculus, we will stick with the simplest 
ideas-no mixing of levels. 

Fallacies can result if you fail to distinguish carefully between working in the 
system (the M-mode) and thinking about the system (the I-mode). For example, it might 
seem perfectly reasonable to assume that, since <Pv~P> (whose semi-interpretation is 
"either P or not P") is a theorem, either P or ~P must be a theorem. But this is dead 
wrong: neither one of the latter pair is a theorem. In general, it is a dangerous practice to 
assume that symbols can be slipped back and forth between different levels-here, the 
language of the formal system and its metalanguage (English). 

The Propositional Calculus 


Reflections on the Strengths and Weaknesses of the System 

You have now seen one example of a system with a purpose-to re part of the architecture 
of logical thought. The concepts which this handles are very few in number, and they are 
very simple, precise co But the simplicity and precision of the Propositional Calculus are 
the kinds of features which make it appealing to mathematicians. There are two reasons 
for this. (1) It can be studied for its own properties, ex geometry studies simple, rigid 
shapes. Variants can be made on it, employing different symbols, rules of inference, 
axioms or axiom schemata on. (Incidentally, the version of the Propositional Calculus 
here pr is related to one invented by G. Gentzen in the early 1930's. The other versions in 
which only one rule of inference is used-detachment usually-and in which there are 
several axioms, or axiom schemata study of ways to carry out propositional reasoning in 
elegant formal systems is an appealing branch of pure mathematics. (2) The Propositional 
Calculus can easily be extended to include other fundamental aspects of reasoning. Some 
of this will be shown in the next Chapter, where the Propositional Calculus is 
incorporated lock, stock and barrel into a much larger and deeper system in which 
sophisticated number-theoretical reasoning can be done. 

Proofs vs. Derivations 

The Propositional Calculus is very much like reasoning in some w one should not equate 
its rules with the rules of human thought. A proof is something informal, or in other 
words a product of normal thought written in a human language, for human consumption. 
All sorts of complex features of thought may be used in proofs, and, though they may 
"feel right", one may wonder if they can be defended logically. That is really what 
formalization is for. A derivation is an artificial counterpart of and its purpose is to reach 
the same goal but via a logical structure whose methods are not only all explicit, but also 
very simple. 

If — and this is usually the case -it happens that a formal derivation is extremely 
lengthy compared with the corresponding "natural" proof that is just too bad. It is the 
price one pays for making each step so simple. What often happens is that a derivation 
and a proof are "simple" in complementary senses of the word. The proof is simple in 
that each step sounds right", even though one may not know just why; the derivation is 
simple in that each of its myriad steps is considered so trivial that it is beyond reproach, 
and since the whole derivation consists just of such trivial steps it is supposedly error- 
free. Each type of simplicity, however, brings along a characteristic type of complexity. 
In the case of proofs, it is the complexity of the underlying system on which they rest — 
namely, human language — and in the case of derivations, it is their astronomical size, 
which makes them almost impossible to grasp. 

Thus, the Propositional Calculus should be thought of as part of a 

The Propositional Calculus 


general method for synthesizing artificial proof-like structures. It does not, however, have 
much flexibility or generality. It is intended only for use in connection with mathematical 
concepts-which are themselves quite rigid. As a rather interesting example of this, let us 
make a derivation in which a very peculiar string is taken as a premise in a fantasy: 
<Pa~P>. At least its semi-interpretation is peculiar. The Propositional Calculus, 
however, does not think about semi-interpretations; it just manipulates strings 
typographically-and typographically, there is really nothing peculiar about this string. 
Here is a fantasy with this string as its premise: 

(1) [ 

(2) <Pa~P> 

(3) P 

(4) ~P 

(5) [ 

(6) ~Q 

(7) P 

(8) ~~P 

(9) ] 

(10) <~Q3~~ P> 

(11) <~P^Q> 

(12) Q 

(13) ] 

(14) «Pa~P >^Q> 







carry-over line 3 





detachment (Lines 4,1 1) 



Now this theorem has a very strange semi-interpretation: 

P and not P together imply Q 

Since Q is interpretable by any statement, we can loosely take the theorem to say that 
"From a contradiction, anything follows"! Thus, in systems based on the Propositional 
Calculus, contradictions cannot be contained; they infect the whole system like an 
instantaneous global cancer. 

The Handling of Contradictions 

This does not sound much like human thought. If you found a contradiction in your own 
thoughts, it's very unlikely that your whole mentality would break down. Instead, you 
would probably begin to question the beliefs or modes of reasoning which you felt had 
led to the contradictory thoughts. In other words, to the extent you could, you would step 
out of the systems inside you which you felt were responsible for the contradiction, and 
try to repair them. One of the least likely things for you to do would be to throw up your 
arms and cry, "Well, I guess that shows that I believe everything now!" As a joke, yes- 
but not seriously. 

Indeed, contradiction is a major source of clarification and progress in all domains 
of life-and mathematics is no exception. When in times past, a 

The Propositional Calculus 


contradiction in mathematics was found, mathematicians would immediately seek to 
pinpoint the system responsible for it, to jump out of it, to reason about it, and to amend 
it. Rather than weakening mathematics, the discovery and repair of a contradiction would 
strengthen it. This might take time and a number of false starts, but in the end it would 
yield fruit. For instance, in the Middle Ages, the value of the infinite series 

1 - 1 + 1 - 1 + 1 -. .. 

was hotly disputed. It was "proven" to equal 0, 1, M>, and perhaps other values. Out of 
such controversial findings came a fuller, deeper about infinite series. 

A more relevant example is the contradiction right now confronting us-namely the 
discrepancy between the way we really think, and t the Propositional Calculus imitates 
us. This has been a source of discomfort for many logicians, and much creative effort has 
gone into trying to patch up the Propositional Calculus so that it would not act so stupidly 
and inflexibly. One attempt, put forth in the book Entailment by A. R. Anderson and N. 
Belnap, 3 involves "relevant implication", which tries to make the symbol for "if-then" 
reflect genuine causality, or at least connect meanings. Consider the following theorems 
of the Propositional Calculus 


They, and many others like them, all show that there need be no relationship at all 
between the first and second clauses of an if-then statement for it to be provable within 
the Propositional Calculus. In protest, "relevant implication" puts certain restrictions on 
the contexts in which the rules of inference can be applied. Intuitively, it says that 
"something can only be derived from something else if they have to do with each other". 
For example, line 10 in the derivation given above would not be allowed in such a 
system, and that would block the derivation of the «Pa~P >z>Q> 

More radical attempts abandon completely the quest for completeness or 
consistency, and try to mimic human reasoning with all its inconsistencies. Such research 
no longer has as its goal to provide a solid underpinning for mathematics, but purely to 
study human thought processes. 

Despite its quirks, the Propositional Calculus has some feat recommend itself. If 
one embeds it into a larger system (as we will do next Chapter), and if one is sure that the 
larger system contains no contradictions (and we will be), then the Propositional Calculus 
does all that one could hope: it provides valid propositional inferences — all that can be 
made. So if ever an incompleteness or an inconsistency is uncovered, can be sure that it 
will be the fault of the larger system, and not of its subsystem which is the Propositional 

The Propositional Calculus 


FIGURE 42. "Crab Canon", by M. C. Escher (-1965) 

Crab Canon 


Crab Canon 

Achilles and the Tortoise happen upon each other 
in the park one day while strolling. 

Tortoise: Good day, Mr. A. 

Achilles: Why, same to you. Tortoise: So nice to run into you. Achilles: That echoes my 

Tortoise: And it's a perfect day for a walk. I think I'll be walking home soon. 

Achilles: Oh, really? I guess there's nothing better for you than w Tortoise: Incidentally, 

you're looking in very fine fettle these days, I must say. 
Achilles: Thank you very much. 
Tortoise: Not at all. Here, care for one of my cigars? 

Achilles: Oh, you are such a philistine. In this area, the Dutch contributions are of 
markedly inferior taste, don't you think? 

Tortoise: I disagree, in this case. But speaking of taste, I finally saw that Crab Canon by 
your favorite artist, M. C. Escher, in a gallery the other day, and I fully appreciate the 
beauty and ingenuity with which he made one single theme mesh with itself going 
both backwards and forwards. But I am afraid I will always feel Bach is superior to 

Crab Canon 


Achilles: I don't know. But one thing for certain is that I don't worry about arguments of 

taste. De gustibus non est disputandum. 
Tortoise: Tell me, what's it like to be your age? Is it true that one has no worries at all? 
Achilles: To be precise, one has no frets. 
Tortoise: Oh, well, it's all the same to me. 

Achilles: Fiddle. It makes a big difference, you know. Tortoise: Say, don't you play the 

Achilles: That's my good friend. He often plays, the fool. But I myself wouldn't touch a 
guitar with a ten-foot pole! 

(Suddenly, the Crab, appearing from out of nowhere, wanders up excitedly, 
pointing to a rather prominent black eye.) 

Crab: Hallo! Hulloo! What's up? What's new? You see this bump, this lump? Given to 
me by a grump. Ho! And on such a fine day. You see, I was just idly loafing about the 
park when up lumbers this giant fellow from Warsaw-a colossal bear of a man- 
playing a lute. He was three meters tall, if I'm a day. I mosey on up to the chap, reach 
skyward and manage to tap him on the knee, saying, "Pardon me, sir, but you are 
Pole-luting our park with your mazurkas." But wow! he had no sense of humor-not a 
bit, not a wit- and POW!-he lets loose and belts me one, smack in the eye! Were it in 
my nature, I would crab up a storm, but in the time-honored tradition of my species, I 
backed off. After all, when we walk forwards, we move backwards. It's in our genes, 
you know, turning round and round. That reminds me-I've always wondered, "Which 
came first-the Crab, or the Gene?" That is to say, "Which came last the Gene, or the 
Crab?" I'm always turning things round and round, you know. It's in our genes, after 
all. When we walk backwards, we move forwards. Ah me, oh my! I must lope along 
on my merry way-so off I go on such a fine day. Sing "ho!" for the life of a Crab! 
TATA! iOle! 

(And he disappears as suddenly as he arrived.) 

Tortoise: That's my good friend. He often plays the fool. But I myself wouldn't touch a 

ten-foot Pole with a guitar! 
Achilles: Say, don't you play the guitar? Tortoise: Fiddle. It makes a big difference, 

Achilles: Oh, well, it's all the same to me. 
Tortoise: To be precise, one has no frets. 

Achilles: Tell me, what's it like to be your age? Is it true that one has no worries at all? 
Tortoise: I don't know. But one thing for certain is that I don't worry about arguments of 
taste. Disputandum non est de gustibus. 

Crab Canon 



FIGURE 43. Here is a short section one of the Crab's 
Genes, turning round and round. When the two DNA 
strands are raveled and laid out side by side, they 
read this way: 


Notice that they are the same, only one forwards while 
the other goes backwards This is the defining 
property of the form called "crab canon " in music. It 
is reminiscent of, though a little different from 
palindrome, which is a sentence that reads the same 
backwards and forwards ,In molecular biology, 
such segments of DNA are called "palindromes "-a 
slight misnomer, since "crab canon " would be more 
accurate. Not only is this DNA segment crab- 
canonical-but moreover its base sequence codes for 
the Dialogue's structure Look carefully! 

Achilles: I disagree, in this case. But speaking of taste, I finally heard that Crab Canon 
by your favorite composer, J. S. Bach, in a concert other day, and I fully appreciate 
the beauty and ingenuity with which he made one single theme mesh with itself going 
both backwards and forwards. But I'm afraid I will always feel Escher is superior to 

Tortoise: Oh, you are such a philistine. In this area, the Dutch contributions are of 

markedly inferior taste, don't you think? 
Achilles: Not at all. Here, care for one of my cigars? 
Tortoise: Thank you very much. 

Achilles: Incidentally, you're looking in very fine fettle these days, I must say. 

Crab Canon 


FIGURE H. Crab Canon fnrn tht Musical Offering, fry J, S. Bath. [Mum prinud fry Donald Bynli pmgnim SMUT.] 

Tortoise: Oh, really? I guess there's nothing better for you than walking. 
Achilles: And it's a perfect day for a walk. I think I'll be walking home soon. 
Tortoise: That echoes my thoughts. 
Achilles: So nice to run into you. 
Tortoise: Why, same to you. 
Achilles: Good day, Mr. T 

Crab Canon 



Typographical Number Theory 

The Crab Canon and Indirect Self-Reference 

THREE EXAMPLES OF indirect self-reference are found in the Crab Canon. Achilles 
and the Tortoise both describe artistic creations they know-and, quite accidentally, those 
creations happen to have the same structure as the Dialogue they're in. (Imagine my 
surprise, when I, the author, noticed this!) Also, the Crab describes a biological structure 
and that, too, has the same property. Of course, one could read the Dialogue and 
understand it and somehow fail to notice that it, too, has the form of a crab canon. This 
would be understanding it on one level, but not on another. To see the self-reference, one 
has to look at the form, as well as the content, of the Dialogue. 

Godel's construction depends on describing the form, as well as the content, of 
strings of the formal system we shall define in this Chapter — Typographical Number 
Theory (TNT). The unexpected twist is that, because of the subtle mapping which Godel 
discovered, the form of strings can be described in the formal system itself. Let us 
acquaint ourselves with this strange system with the capacity for wrapping around. 

What We Want to Be Able to Express in TNT 

We'll begin by citing some typical sentences belonging to number theory; then we will 
try to find a set of basic notions in terms of which all our sentences can be rephrased. 
Those notions will then be given individual symbols. Incidentally, it should be stated at 
the outset that the term "number theory" will refer only to properties of positive integers 
and zero (and sets of such integers). These numbers are called the natural numbers. 
Negative numbers play no role in this theory. Thus the word "number", when used, will 
mean exclusively a natural number. And it is important — vital-for you to keep separate in 
your mind the formal system (TNT) and the rather ill-defined but comfortable old branch 
of mathematics that is number theory itself; this I shall call "N". 
Some typical sentences of N-number theory-are: 

(1) 5 is prime. 

(2) 2 is not a square. 

(3) 1729 is a sum of two cubes. 

(4) No sum of two positive cubes is itself a cube. 

(5) There are infinitely many prime numbers. 

(6) 6 is even. 

Typographical Number Theory 


Now it may seem that we will need a symbol for each notion such as "prime" or "cube" 
or "positive" — but those notions are really not primitive. Primeness, for instance, has to 
do with the factors which a number has, which in turn has to do with multiplication. 
Cubeness as well is defined in terms multiplication. Let us rephrase the sentences, then, 
in terms of what seem to be more elementary notions. 

(1) There do not exist numbers a and b, both greater than 1. such that 5 equals a 
times b. 

(2) There does not exist a number b, such that b times b equals 2. 

(3) There exist numbers b and c such that b times b times b, plus c times c times c, 
equals 1729. 

(4') For all numbers b and c, greater than 0, there is no number a such that a times a 
times a equals b times b times b plus c times c times c. 

(5) For each number a, there exists a number b, greater than a, with the property 
that there do not exist numbers c and d, both greater than 1 , such that b equals c 
times d. 

(6') There exists a number e such that 2 times e equals 6. 

This analysis has gotten us a long ways towards the basic elements of language of 
number theory. It is clear that a few phrases reappear over a over: 

for all numbers b 

there exists a number b, such that 

greater than 





Most of these will be granted individual symbols. An exception is "greater than", which 
can be further reduced. In fact, the sentence "a is greater than b" becomes 

there exists a number c, not equal to 0, such that a equals b plus c. 


We will not have a distinct symbol for each natural number. Instead, we have a very 
simple, uniform way of giving a compound symbol to e natural number — very much as 
we did in the pq-system. Here is notation for natural numbers: 

Typographical Number Theory 









The symbol S has an interpretation-"the successor of. Hence, the interpretation of SSO 
is literally "the successor of the successor of zero". Strings of this form are called 

Clearly, we need a way of referring to unspecified, or variable, numbers. For that, we will 
use the letters a, b, c, d, e. But five will not be enough. We need an unlimited supply of 
them, just as we had of atoms in the Propositional Calculus. We will use a similar method 
for making more variables: tacking on any number of primes. (Note: Of course the 
symbol '"-read "prime"-is not to be confused with prime numbers!) For instance: 

are all variables. 

In a way it is a luxury to use the first five letters of the alphabet when we could 
get away with just a and the prime. Later on, I will actually drop b, c, d, and e, which will 
result in a sort of "austere" version of TNT-austere in the sense that it is a little harder to 
decipher complex formulas. But for now we'll be luxurious. 

Now what about addition and multiplication? Very simple: we will use the 
ordinary symbols and However, we will also introduce a parenthesizing 
requirement (we are now slowly slipping into the rules which define well-formed strings 
of TNT). To write "b plus c" and "b times c", for instance, we use the strings 

There is no laxness about such parentheses; to violate the convention is to produce a non- 
well-formed formula. ("Formula"? I use the term instead of "string" because it is 
conventional to do so. A formula is no more and no less than a string of TNT.) 

Incidentally, addition and multiplication are always to be thought of as binary operations- 
that is, they unite precisely two numbers, never three or more. Hence, if you wish to 
translate "1 plus 2 plus 3", you have to decide which of the following two expressions 
you want: 

Variables and Terms 





Typographical Number Theory 



The next notion we'll symbolize is equals. That is very simple: we use '='.The advantage 
of taking over the standard symbol used N -- nonformal number theory — iis obvious: 
easy legibility. The disadvantage is very much like the disadvantage of using the words 
"point" a "line" in a formal treatment of geometry: unless one is very conscious a careful, 
one may blur the distinction between the familiar meaning and strictly rule-governed 
behavior of the formal symbol. In discuss geometry, I distinguished between the 
everyday word and the formal to by capitalizing the formal term: thus, in elliptical 
geometry, a POINT was 1 union of two ordinary points. Here, there is no such 
distinction; hen mental effort is needed not to confuse a symbol with all of the association 
is laden with. As I said earlier, with reference to the pq-system: the string — is not the 
number 3, but it acts isomorphically to 3, at least in the context of additions. Similar 
remarks go for the string SSSO. 

Atoms and Propositional Symbols 

All the symbols of the Propositional Calculus except the letters used making atoms (P, Q, 
and R) will be used in TNT, and they retain their interpretations. The role of atoms will 
be played by strings which, when interpreted, are statements of equality, such as 
SO=SSO or (SO • SO) Now, we have the equipment to do a fair amount of translation of 
simple sentences into the notation of TNT: 

2 plus 3 equals 4: (SSO+SSSO)=SSSSO 
2 plus 2 is not equal to 3 : ~(SSO+SSO)=SSSO 
If 1 equals 0, then 0 equals 1 : <SO=0 JO=SO> 

The first of these strings is an atom; the rest are compound formulas (Warning: The "and' 
in the phrase "I and 1 make 2" is just another word for "plus', and must be represented by 
"+' (and the requisite parentheses).) 

Free Variables and Quantifiers 

All the well-formed formulas above have the property that their interpretations are 
sentences which are either true or false. There are, however, well-formed formulas which 
do-not have that property, such as this one 


Its interpretation is "b plus 1 equals 2". Since b is unspecified, there is way to assign a 
truth value to the statement. It is like an out-of-context statement with a pronoun, such as 
"she is clumsy". It is neither true nor false; it is waiting for you to put it into a context. 
Because it is neither true nor false, such a formula is called open, and the variable b is 
called a free variable. 

Typographical Number Theory 


One way of changing an open formula into a closed formula, or sentence, is by 
prefixing it with a quantifier-cither the phrase "there exists a number b such that , or the 
phrase "for all numbers b". In the first instance, you get the sentence 

There exists a number b such that b plus 1 equals 2. 

Clearly this is true. In the second instance, you get the sentence 

For all numbers b, b plus 1 equals 2. 

Clearly this is false. We now introduce symbols for both of these quantifiers. These 
sentences are translated into TNT-notation as follows: 

3b:(b+SO)=SSO ('3' stands for 'exists'.) 
¥b:(b+SO)=SSO ('¥' stands for 'all'.) 

It is very important to note that these statements are no longer about unspecified 
numbers; the first one is an assertion of existence, and the second one is a universal 
assertion. They would mean the same thing, even if written with c instead of b: 

3c:(c+SO)=SSO ' 

A variable which is under the dominion of a quantifier is called a quantified variable. The 
following two formulas illustrate the difference between free variables and quantified 

(b.b)=SSO (open) 

— 3b:(b-b)=SSO (closed; a sentence of TNT) 

The first one expresses a property which might be possessed by some natural number. Of 
course, no natural number has that property. And that is precisely what is expressed by 
the second one. It is very crucial to understand this difference between a string with a free 
variable, which expresses a property, and a string where the variable is quantified, which 
expresses a truth or falsity. The English translation of a formula with at least one free 
variable-an open formula-is called a predicate. It is a sentence without a subject (or a 
sentence whose subject is an out-of-context pronoun). For instance, 

"is a sentence without a subject" 

"would be an anomaly" 

"runs backwards and forwards simultaneously" 

"improvised a six -part fugue on demand" 

are nonarithmetical predicates. They express properties which specific entities might or 
might not possess. One could as well stick on a "dummy 

Typographical Number Theory 


subject", such as "so-and-so". A string with free variables is like a predicate with "so- 
and-so" as its subject. For instance, 


is like saying "1 plus 1 equals so-and-so". This is a predicate in the variable b. It 
expresses a property which the number b might have. If one wet substitute various 
numerals for b, one would get a succession of forms most of which would express 
falsehoods. Here is another example of difference between open formulas and sentences: 


The above formula is a sentence representing, of course, the commutativity of addition. 
On the other hand, 


is an open formula, since b is free. It expresses a property which unspecified number b 
might or might not have — namely of commuting with all numbers c. 

Translating Our Sample Sentences 

This completes the vocabulary with which we will express all num theoretical statements! 
It takes considerable practice to get the hang of expressing complicated statements of N 
in this notation, and converse] figuring out the meaning of well-formed formulas. For this 
reason return to the six sample sentences given at the beginning, and work their 
translations into TNT. By the way, don't think that the translations given below are 
unique-far from it. There are many — infinitely many — ways to express each one. 

Let us begin with the last one: "6 is even". This we rephrased in to of more 
primitive notions as "There exists a number e such that 2 times e equals 6". This one is 

3e:(SSO. e)=SSSSSSO 

Note the necessity of the quantifier; it simply would not do to write 


alone. This string's interpretation is of course neither true nor false; it expresses a 
property which the number e might have. 

It is curious that, since we know multiplication is commutative might easily have 


3e:(e - SSO)=SSSSSSO 

instead. Or, knowing that equality is a symmetrical relation, we might 1 chosen to write 
the sides of the equation in the opposite order: 

Typographical Number Theory 


3e:SSSSSSO=(SSO • e) 

Now these three translations of "6 is even" are quite different strings, and it is by no 
means obvious that theoremhood of any one of them is tied to theoremhood of any of the 
others. (Similarly, the fact that ~p-q — was a theorem had very little to do with the fact 
that its "equivalent" string -p~q — was a theorem. The equivalence lies in our minds, 
since, as humans, we almost automatically think about interpretations, not structural 
properties of formulas.) 

We can dispense with sentence 2: "2 is not a square", almost immediately: 

-3b:(b • b)=SSO 

However, once again, we find an ambiguity. What if we had chosen to write it this way? 

Vb: -(b • b) =SSO 

The first way says, "It is not the case that there exists a number b with the property that 
b's square is 2", while the second way says, "For all numbers b, it is not the case that b's 
square is 2." Once again, to us, they are conceptually equivalent-but to TNT, they are 
distinct strings. 

Let us proceed to sentence 3: "1729 is a sum of two cubes." This one will involve 
two existential quantifiers, one after the other, as follows: 

3b:3c:SSSSSS SSSSSO=(((b • b) • b)+((c • c) • c)) 

1729 of them 

There are alternatives galore. Reverse the order of the quantifiers; switch the sides of the 
equation; change the variables to d and e; reverse the addition; write the multiplications 
differently; etc., etc. However, I prefer the following two translations of the sentence: 

((SSSSSSSSSO • SSSSSSSSSO) • SSSSSSSSSO))=(((b • b) • b)+((c • c) • c)) 


((SO -SO) • SO))=(((b «b) -b)+((c • c) -c)) 

Do you see why? 

Tricks of the Trade 

Now let us tackle the related sentence 4: "No sum of two positive cubes is itself a cube". 
Suppose that we wished merely to state that 7 is not a sum of two positive cubes. The 
easiest way to do this is by negating the formula 

Typographical Number Theory 


which asserts that 7 is a sum of two positive cubes. This will be just like the preceding 
sentence involving 1729, except that we have to add in the proviso of the cubes being 
positive. We can do this with a trick: prefix variables with the symbol S, as follows: 

3b:3c:SSSSSSSO=(((Sb • Sb) • Sb)+((Sc • Sc) -Sc)) 

You see, we are cubing not b and c, but their successors, which must be positive, since 
the smallest value which either b or c can take on is zero. Hence the right-hand side 
represents a sum of two positive cubes. In( tally, notice that the phrase "there exist 

numbers b and c such that ") when translated, does not involve the symbol n' which 

stands for 'and'. That symbol is used for connecting entire well-formed strings, not for 
joining two quantifiers. 

Now that we have translated "7 is a sum of two positive cubes", we wish to negate 
it. That simply involves prefixing the whole thing by a single (Note: you should not 
negate each quantifier, even though the desired phrase runs "There do not exist numbers 
b and c such that ...".) Thus we get: 

-3b:3c:SSSSSSSO=(((Sb • Sb) • Sb)+((Sc -Sc) -Sc)) 

Now our original goal was to assert this property not of the number of all cubes. 
Therefore, let us replace the numeral SSSSSSSO by the ((a-a)-a), which is the translation 
of "a cubed": 

3b:3c:((a -a) -a)=(((Sb -Sb) • Sb)+((Sc -Sc) -Sc)) 

At this stage, we are in possession of an open formula, since a is still free. This formula 
expresses a property which a number a might or might not have-and it is our purpose to 
assert that all numbers do have that property. That is simple — just prefix the whole thing 
with a universal quantifier 

¥a:-3b:3c:((a -a) • a)=(((Sb • Sb) • Sb) +((Sc -Sc) -Sc)) 

An equally good translation would be this: 

-3a:3b:3c:((a-a) a)=(((Sb-Sb)-Sb)+((Sc-Sc)-Sc)) 

In austere TNT, we could use a' instead of b, and a" instead of c, and the formula would 

-3a: 3a': 3a":((a • a) • a) =(((Sa' . Sa') • Sa') +((Sa" • Sa") • Sa")) 

What about sentence 1: "5 is prime"? We had reworded it in this way "There do not exist 
numbers a and b, both greater than 1, such equals a times b". We can slightly modify it, 
as follows: "There do not exist numbers a and b such that 5 equals a plus 2, times b plus 
2". This is another trick-since a and b are restricted to natural number values, this is an 
adequate way to say the same thing. Now "b plus 2" could be translated into 

Typographical Number Theory 


(b+SSO), but there is a shorter way to write it — namely, SSb. Likewise, "c plus 2" can 
be written SSc. Now, our translation is extremely concise: 

3b: 3c:SSSSSO=(SSb • SSc) 

Without the initial tilde, it would be an assertion that two natural numbers do exist, 
which, when augmented by 2, have a product equal to 5. With the tilde in front, that 
whole statement is denied, resulting in an assertion that 5 is prime. 

If we wanted to assert that d plus e plus 1, rather than 5, is prime, the most 
economical way would be to replace the numeral for 5 by the string (d+Se): 

3b: 3c:(d+Se)=(SSb SSc) 

Once again, an open formula, one whose interpretation is neither a true nor a false 
sentence, but just an assertion about two unspecified numbers, d and e. Notice that the 
number represented by the string (d+Se) is necessarily greater than d, since one has 
added to d an unspecified but definitely positive amount. Therefore, if we existentially 
quantify over the variable e, we will have a formula which asserts that: 

There exists a number which is greater than d and which is prime. 

3e:- 3b:3c:(d+Se)=(SSb • SSc) 

Well, all we have left to do now is to assert that this property actually obtains, no matter 
what d is. The way to do that is to universally quantify over the variable d: 

Vd:3e:-3b:3c:(d+Se)=(SSb -SSc) 

That's the translation of sentence 5 ! 

Translation Puzzles for You 

This completes the exercise of translating all six typical number-theoretical sentences. 
However, it does not necessarily make you an expert in the notation of TNT. There are 
still some tricky issues to be mastered. The following six well-formed formulas will test 
your understanding of TNT notation. What do they mean? Which ones are true (under 
interpretation, of course), and which ones are false? (Hint: the way to tackle this exercise 
is to move leftwards. First, translate the atom; next, figure out what adding a single 
quantifier or a tilde does; then move leftwards, adding another quantifier or tilde; then 
move leftwards again, and do the same.) 

-¥c: 3b:(SSO • b)=c 

¥c:- 3b:(SSO • b)=c 

Typographical Number Theory 


Ate: 3b:— (SSO • b)=c 
~3b:¥c:(SSO • b)=c 
3b:-¥c:(SSO • b)=c 
3b:^c:-(SSO • b)=c 

(Second hint: Either four of them are true and two false, or four false and two true.) 
How to Distinguish True from False? 

At this juncture, it is worthwhile pausing for breath and contempt what it would mean to 
have a formal system that could sift out the true from the false ones. This system would 
treat all these strings-which look like statements-as designs having form, but no content. 
An( system would be like a sieve through which could pass only designs v special style- 
the "style of truth". If you yourself have gone through ti formulas above, and have 
separated the true from the false by this about meaning, you will appreciate the subtlety 
that any system would to have, that could do the same thing-but typographically! The 
bout separating the set of true statements from the set of false statements written in the 
TNT-notation) is anything but straight; it is a boundary with many treacherous curves 
(recall Fig. 1 8), a boundary of which mathematicians have delineated stretches, here and 
there, working over hundreds years. Just think what a coup it would be to have a 
typographical m( which was guaranteed to place any formula on the proper side o border! 

The Rules of Well-Formedness 

It is useful to have a table of Rules of Formation for well-formed formulas This is 
provided below. There are some preliminary stages, defining numerals, variables, and 
terms. Those three classes of strings are ingredients of well-formed formulas, but are not 
in themselves well-formed. The smallest well-formed formulas are the atoms; then there 
are ways of compounding atoms. Many of these rules are recursive lengthening rules, in 
that they take as input an item of a given class and produce a longer item of the class. In 
this table, I use V and 'y' to stand for well-formed formulas, and Y, Y, and V to stand 
for other kinds of TNT-strings. Needless to say, none of these five symbols is itself a 
symbol of TNT. 


0 is a numeral. 

A numeral preceded by S is also a numeral. 

Typographical Number Theory 



a is a variable. If we're not being austere, so are b, c, d and e. A variable followed 
by a prime is also a variable. 
Examples: a b' c" d"' a"" 


All numerals and variables are terms. 

A term preceded by S is also a term. 

If s and t are terms, then so are (s+ t) and (s • t). 

Examples: 0 b SSa' (SO • (SSO+c)) S(Sa • (Sb • Sc)) 

TERMS may be divided into two categories: 

(1) DEFINITE terms. These contain no variables. 
Examples: 0 (SO+SO) SS((SSO.SSO)+(SO.SO)) 

(2) INDEFINITE terms. These contain variables. 
Examples: b Sa (b+SO) (((SO+SO)+SO)+e) 

The above rules tell how to make parts of well-formed formulas; the remaining 
rules tell how to make complete well-formed formulas. 


If s and t are terms, then s = t is an atom. 

Examples: SO=0 (SS0+SS0)=5SSS0 5(b+c)=((c-d).e) 

If an atom contains a variable u, then u is free in it. Thus there are 
four free variables in the last example. 

A well-formed formula preceded by a tilde is well-formed. 
Examples: ~S0=0 ~3b:(b+b)=SO -<O=03S0=O> ~b=SO 

The quantification status of a variable (which says whether the variable is 
free or quantified) does not change under negation. 


If x and y are well-formed formulas, and provided that no variable which is free in 

one is quantified in the other, then the following are all well-formed formulas: 

< xa y>, < xv y>, < xd y>. 

Examples: <O=Oa~-0=0> <b=bv~3c:c=b> 


The quantification status of a variable doesn't change here. 

If u is a variable, and x is a well-formed formula in which u is free then the 
following strings are well-formed formulas: 
3u: x and ¥u: x. 

Examples: ¥b:<b=bv~3c:c=b> vc:~3b:(b+b)=c ~3c:Sc=d 
OPEN FORMULAS contain at least one free variable. 

Examples: — c=c b=b <¥b:b=bn — c=c> 
CLOSED FORMULAS (SENTENCES) contain no free variables. 

Examples: 50=0 ~¥d:d=0 3c:<¥b:b=bA~c=c> 

Typographical Number Theory 


This completes the table of Rules of Formation for the well-formed formulas of TNT. 

A Few More Translation Exercises 

And now, a few practice exercises for you, to test your understanding of the notation of 
TNT. Try to translate the first four of the following N-sentences into TNT-sentences, and 
the last one into an open formed formula. 

All natural numbers are equal to 4. 

There is no natural number which equals its own square. 

Different natural numbers have different successors. 

If 1 equals 0, then every number is odd. 
b is a power of 2. 

The last one you may find a little tricky. But it is nothing, compared to this one: 
b is a power of 10. 

Strangely, this one takes great cleverness to render in our notation. I would caution you to 
try it only if you are willing to spend hours and hours on it — and if you know quite a bit 
of number theory! 

A Non typographical System 

This concludes the exposition of the notation of TNT; however, we still left with the 
problem of making TNT into the ambitious system which we have described. Success 
would justify the interpretations which we given to the various symbols. Until we have 
done that, however, particular interpretations are no more justified than the "horse-apple 
happy" interpretations were for the pq-system's symbols. 

Someone might suggest the following way of constructing TNT: (1|) Do not have 
any rules of inference; they are unnecessary, because (2) We take as axioms all true 
statements of number theory (as written in TNT-notation). What a simple prescription! 
Unfortunately it is as empty as instantaneous reaction says it is. Part (2) is, of course, not 
a typographical description of strings. The whole purpose of TNT is to figure out if and 
how it is possible to- characterize the true strings typographically. 

The Five Axioms and First Rules of TNT 

Thus we will follow a more difficult route than the suggestion above; we will have 
axioms and rules of inference. Firstly, as was promised, all of the rules of the 
Propositional Calculus are taken over into TNT. Therefore one theorem of TNT will be 
this one: 


Typographical Number Theory 


which can be derived in the same way as <Pv-P> was derived. 

Before we give more rules, let us give the five axioms of TNT: 

Axiom 1 : ¥a:~Sa=0 

Axiom 2: ¥a:(a+0)=a 

Axiom 3: ¥a:¥b:(a+Sb)=S(a+b) 

Axiom 4: ¥a:(a-0)=0 

Axiom 5: ¥a:¥b:(a-Sb)=((a-b)+a) 

(In the austere versions, use a' instead of b.) All of them are very simple to understand. 
Axiom 1 states a special fact about the number 0; Axioms 2 and 3 are concerned with the 
nature of addition; Axioms 4 and 5 are concerned with the nature of multiplication, and in 
particular with its relation to addition. 

The Five Peano Postulates 

By the way, the interpretation of Axiom l-"Zero is not the successor of any natural 
number" -is one of five famous properties of natural numbers first explicitly recognized 
by the mathematician and logician Giuseppe Peano, in 1889. In setting out his postulates, 
Peano was following the path of Euclid in this way: he made no attempt to formalize the 
principles of reasoning, but tried to give a small set of properties of natural numbers from 
which everything else could be derived by reasoning. Peano's attempt might thus be 
considered "semiformal". Peano's work had a significant influence, and thus it would be 
good to show Peano's five postulates. Since the notion of "natural number" is the one 
which Peano was attempting to define, we will not use the familiar term "natural 
number", which is laden with connotation. We will replace it with the undefined term 
djinn, a word which comes fresh and free of connotations to our mind. Then Peano's five 
postulates place five restrictions on djinns. There are two other undefined terms: Genie, 
and meta. I will let you figure out for yourself what usual concept each of them is 
supposed to represent. The five Peano postulates: 

(1) Genie is a djinn. 

(2) Every djinn has a mesa (which is also a djinn). 

(3) Genie is not the mesa of any djinn. (4) Different djinns have different metas. 
(5) If Genie has X, and each djinn relays X to its mesa, then all djinns get X. 

In light of the lamps of the Little Harmonic Labyrinth, we should name the set of all 
djinns "GOD". This harks back to a celebrated statement by the German mathematician 
and logician Leopold Kronecker, archenemy of Georg Cantor: "God made the natural 
numbers; all the rest is the work of man." 

Typographical Number Theory 


You may recognize Peano's fifth postulate as the principle of mathematical 
induction-another term for a hereditary argument. Peano he that his five restrictions on 
the concepts "Genie", "djinn", and "mesa" so strong that if two different people formed 
images in their minds o concepts, the two images would have completely isomorphic 
structures, example, everybody's image would include an infinite number of distinct 
djinns. And presumably everybody would agree that no djinn coins with its own meta, or 
its meta's meta, etc. 

Peano hoped to have pinned down the essence of natural numbers in his five 
postulates. Mathematicians generally grant that he succeeded that does not lessen the 
importance of the question, "How is a true statement about natural numbers to be 
distinguished from a false one?" At answer this question, mathematicians turned to totally 
formal systems, as TNT. However, you will see the influence of Peano in TNT, because 
all of his postulates are incorporated in TNT in one way or another. 

New Rules of TNT: Specification and Generalization 

Now we come to the new rules of TNT. Many of these rules will allow reach in and 
change the internal structure of the atoms of TNT. In sense they deal with more 
"microscopic" properties of strings than the of the Propositional Calculus, which treat 
atoms as indivisible units, example, it would be nice if we could extract the string -SO=0 
from the first axiom. To do this we would need a rule which permits us to di universal 
quantifier, and at the same time to change the internal strut of the string which remains, if 
we wish. Here is such a rule: 

RULE OF SPECIFICATION: Suppose u is a variable which occurs inside string x. If the 
string ¥u:x is a theorem, then so is x, and so an strings made from x by replacing u, 
wherever it occurs, by one the same term. 

{Restriction: The term which replaces u must not contain any vat that is quantified 
in x.) 

The rule of specification allows the desired string to be extracted Axiom 1 . It is a one- 
step derivation: 

¥a -Sa=0 axiom 1 

~S0=0 specification 

Notice that the rule of specification will allow some formulas which co: free variables 
(i.e., open formulas) to become theorems. For example following strings could also be 
derived from Axiom 1 , by specification: 


There is another rule, the rule of generalization, which allows us to put 

Typographical Number Theory 


back the universal quantifier on theorems which contain variables that became free as a 
result of usage of specification. Acting on the lower string, for example, generalization 
would give: 


Generalization undoes the action of specification, and vice versa. Usually, generalization 
is applied after several intermediate steps have transformed the open formula in various 
ways. Here is the exact statement of the rule: 

RULE OF GENERALIZATION: Suppose x is a theorem in which u, a variable, occurs 
free. Then ¥u:x is a theorem. 

( Restriction: No generalization is allowed in a fantasy on any variable which 
appeared free in the fantasy's premise.) 

The need for restrictions on these two rules will shortly be demonstrated explicitly. 
Incidentally, this generalization is the same generalization as was mentioned in Chapter 
II, in Euclid's proof about the infinitude of primes. Already we can see how the symbol- 
manipulating rules are starting to approximate the kind of reasoning which a 
mathematician uses. 

The Existential Quantifier 

These past two rules told how to take off universal quantifiers and put them back on; the 
next two rules tell how to handle existential quantifiers. 

RULE OF INTERCHANGE: Suppose u is a variable. Then the strings Vu:- and -3u: are 
interchangeable anywhere inside any theorem. 

For example, let us apply this rule to Axiom 1 : 

¥a:-Sa=0 axiom 1 
~3a:Sa=0 interchange 

By the way, you might notice that both these strings are perfectly natural renditions, in 
TNT, of the sentence "Zero is not the successor of any natural number". Therefore it is 
good that they can be turned into each other with ease. 

The next rule is, if anything, even more intuitive. It corresponds to the very 
simple kind of inference we make when we go from "2 is prime" to "There exists a 
prime". The name of this rule is self-explanatory: 

RULE OF EXISTENCE: Suppose a term (which may contain variables as long as they 
are free) appears once, or multiply, in a theorem. Then any (or several, or all) of the 
appearances of the term may be replaced by a variable which otherwise does not occur in 
the theorem, and the corresponding existential quantifier must be placed in front. 

Let us apply the rule to —as usual— Axiom 1 : 

Typographical Number Theory 


¥a:-Sa=0 axiom 1 
3b:¥a:-Sa=b existence 

You might now try to shunt symbols, according to rules so far giver produce the theorem 
~¥b: 3a:Sa=b. 

Rules of Equality and Successorship 

We have given rules for manipulating quantifiers, but so far none for symbols ,= ' and 'S'. 
We rectify that situation now. In what follows, r, s, t all stand for arbitrary terms. 


SYMMETRY: If r = s is a theorem, then so is s = r. 
TRANSITIVITY: If r = s and s = t are theorems, then so is r = t. 


ADD S: If r = t is a theorem, then Sr = St is a theorem. 

DROP S: If Sr = St is a theorem, then r = t is a theorem. 

Now we are equipped with rules that can give us a fantastic variet theorems. For 
example, the following derivations yield theorems which pretty fundamental: 



axiom 3 



specification (SO for a) 



specification (0 for b) 



axiom 2 



specification (SO for a) 






* * * 

transitivity (lines 3,6) 
* * 



axiom 5 


¥b: (SO-Sb)=((SO-b)+SO) 

specification (SO for a) 



specification (0 for b) 



axiom 3 


¥b:((SO.O)+Sb)=S((50 0)+b) 

specification ((SO-0) for a) 


((SO .0)+SO)=S((SO.0)+0) 

specification (0 for b) 



axiom 2 



specification ((S0.0) for a) 



axiom 4 



specification (SO for a) 



transitivity (lines 8,10) 





((SO -0)+SO)=SO 

transitivity (lines 6,12) 



transitivity (lines 3,13) 

Typographical Number Theory 


Illegal Shortcuts 

Now here is an interesting question: "How can we make a derivation for the string 0=0?" 
It seems that the obvious route to go would be first to derive the string ¥a:a=a, and then 
to use specification. So, what about the following "derivation" of ¥a:a=a ... What is 
wrong with it? Can you fix it up? 

(1) ¥a:(a+0)=a axiom 2 

(2) ¥a:a=(a+0) symmetry 

(3) ¥a:a=a transitivity (lines 2,1) 

I gave this mini-exercise to point out one simple fact: that one should not jump too fast in 
manipulating symbols (such as ,= ') which are familiar. One must follow the rules, and not 
one's knowledge of the passive meanings of the symbols. Of course, this latter type of 
knowledge is invaluable in guiding the route of a derivation. 

Why Specification and Generalization Are Restricted 

Now let us see why there are restrictions necessary on both specification and 
generalization. Here are two derivations. In each of them, one of the restrictions is 
violated. Look at the disastrous results they produce: 









generalization (Wrongl) 









fantasy rule 









previous theorem 



detachment (lines 9,8) 


is the first disaster. The other one is via faulty specification. 



previous theorem 








¥a: 3b:b=Sa 




specification (Wrongl) 

So now you can see why those restrictions are needed. 

Here is a simple puzzle: translate (if you have not already done so) Peano's fourth 
postulate into TNT-notation, and then derive that string as a theorem. 

Typographical Number Theory 


Something Is Missing 

Now if you experiment around for a while with the rules and axioms of TNT so far 
presented, you will find that you can produce the following pyramidal family of theorems 
(a set of strings all cast from an identical mold, differing from one another only in that the 
numerals 0, SO, SSO, and s have been stuffed in): 



As a matter of fact, each of the theorems in this family can be derived the one directly 
above it, in only a couple of lines. Thus it is a so "cascade" of theorems, each one 
triggering the next. (These theorem very reminiscent of the pq-theorems, where the 
middle and right-] groups of hyphens grew simultaneously.) 

Now there is one string which we can easily write down, and v summarizes the 
passive meaning of them all, taken together. That un sally quantified summarizing string 
is this: 


Yet with the rules so far given, this string eludes production. Ti produce it yourself if you 
don't believe me. 

You may think that we should immediately remedy the situation the following 

(PROPOSED) RULE OF ALL: If all the strings in a pyramidal family are theorems, then 
so is the universally quantified string which summarizes them. 

The problem with this rule is that it cannot be used in the M-mode. people who are 
thinking about the system can ever know that an infinite set of strings are all theorems. 
Thus this is not a rule that can be stuck i any formal system. 

co-Incomplete Systems and Undecidable Strings 

So we find ourselves in a strange situation, in which we can typographically produce 
theorems about the addition of any specific numbers, but even a simple string as the one 
above, which expresses a property of addition in general, is not a theorem. You might 
think that is not all that strange, we were in precisely that situation with the pq-system. 
However, the pq-system had no pretensions about what it ought to be able to do; and ii 

Typographical Number Theory 


there was no way to express general statements about addition in its symbolism, let alone 
prove them. The equipment simply was not there, and it did not even occur to us to think 
that the system was defective. Here, however, the expressive capability is far stronger, 
and we have correspondingly higher expectations of TNT than of the pq-system. If the 
string above is not a theorem, then we will have good reason to consider TNT to be 
defective. As a matter of fact, there is a name for systems with this kind of defect-they 
are called {^-incomplete. (The prefix 'co'-'omega'- comes from the fact that the totality of 
natural numbers is sometimes denoted by 'Cfl'.) Here is the exact definition: 

A system is (0-incomplete if all the strings in a pyramidal family are theorems, but 
the universally quantified summarizing string is not a theorem. 

Incidentally, the negation of the above summarizing string 


-is also a nontheorem of TNT. This means that the original string is undecidable within 
the system. If one or the other were a theorem, then we would say that it was decidable. 
Although it may sound like a mystical term, there is nothing mystical about 
undecidability within a given system. It is only a sign that the system could be extended. 
For example, within absolute geometry, Euclid's fifth postulate is undecidable. It has to 
be added as an extra postulate of geometry, to yield Euclidean geometry; or conversely, 
its negation can be added, to yield non-Euclidean geometry. If you think back to 
geometry, you will remember why this curious thing happens. It is because the four 
postulates of absolute geometry simply do not pin down the meanings of the terms 
"point" and "line", and there is room for different extensions of the notions. The points 
and lines of Euclidean geometry provide one kind of extension of the notions of "point" 
and "line"; the POINTS and LINES of non-Euclidean geometry, another. However, using 
the pre-flavored words "point" and "line" tended, for two millennia, to make people 
believe that those words were necessarily univalent, capable of only one meaning. 

Non-Euclidean TNT 

We are now faced with a similar situation, involving TNT. We have adopted a notation 
which prejudices us in certain ways. For instance, usage of the symbol H'tends to make 
us think that every theorem with a plus sign in it ought to say something known and 
familiar and "sensible" about the known and familiar operation we call "addition". 
Therefore it would run against the grain to propose adding the following "sixth axiom": 


Typographical Number Theory 


It doesn't jibe with what we believe about addition. But it is one possible extension of 
TNT, as we have so far formulated TNT. The system which uses this as its sixth axiom is 
a consistent system, in the sense of not has, two theorems of the form x and - x. However, 
when you juxtapose this "sixth axiom" with the pyramidal family of theorems shown 
above, you will probably be bothered by a seeming inconsistency between the family and 
the new axiom. But this kind of inconsistency is riot so damaging as the other kind 
(where x and x are both theorems). In fact, it is not a true inconsistency, because there is 
a way of interpreting the symbols so that everything comes out all right. 

(O-Inconsistency Is Not the Same as Inconsistency 

This kind of inconsistency, created by the opposition of (1) a pyramidal family of 
theorems which collectively assert that all natural numbers have some property, and (2) a 
single theorem which seems to assert that not all numbers have it, is given the name of w- 
inconsistency . An w-inconsistent system is more like the at-the-outset-distasteful-but-in- 
the-end-accept non-Euclidean geometry. In order to form a mental model of what is 
going on, you have to imagine that there are some "extra", unsuspected numbers—let us 
not call them "natural", but supernatural numbers-which have no numerals. Therefore, 
facts about them cannot be represented in the pyramidal family. (This is a little bit like 
Achilles' conception GOD-as a sort of "superdjinn", a being greater than any of the djinn 
This was scoffed at by the Genie, but it is a reasonable image, and may I you to imagine 
supernatural numbers.) 

What this tells us is that the axioms and rules of TNT, as so presented, do not 
fully pin down the interpretations for the symbol TNT. There is still room for variation in 
one's mental model of the notions they stand for. Each of the various possible extensions 
would pin d, some of the notions further; but in different ways. Which symbols we begin 
to take on "distasteful" passive meanings, if we added the "s axiom" given above? Would 
all of the symbols become tainted, or we some of them still mean what we want them to 
mean? I will let you tt about that. We will encounter a similar question in Chapter XIV, 
discuss the matter then. In any case, we will not follow this extension r but instead go on 
to try to repair the w-incompleteness of TNT. 

The Last Rule 

The problem with the "Rule of All" was that it required knowing that all lines of an 
infinite pyramidal family are theorems — too much for a finite being. But suppose that 
each line of the pyramid can be derived from its predecessor in a patterned way. Then 
there would be a finite reason accounting for the fact that all the strings in the pyramid 
are theorems. The trick then, is to find the pattern that causes the cascade, and show that 

Typographical Number Theory 


pattern is a theorem in itself. That is like proving that each djinn passes a message to its 
meta, as in the children's game of "Telephone". The other thing left to show is that Genie 
starts the cascading message-that is, to establish that the first line of the pyramid is a 
theorem. Then you know that GOD will get the message! 

In the particular pyramid we were looking at, there is a pattern, captured by lines 
4-9 of the derivation below. 

(1) ¥a:¥b:(a+Sb)=S(a+b) axiom 3 

(2) ¥b:(0+Sb)=S(0+b) specification 

(3) (0+Sb)=S(0+b) specification 

(4) [ push 

(5) (0+b)=b premise 

(6) S(0+b)=Sb add S 

(7) (0+Sb)=S(0+b) carry over line 3 

(8) (0+Sb)=Sb transitivity 

(9) ] pop 

The premise is (0+b)=b; the outcome is (0+Sb)=Sb. 

The first line of the pyramid is also a theorem; it follows directly from Axiom 2. 
All we need now is a rule which lets us deduce that the string which summarizes the 
entire pyramid is itself a theorem. Such a rule will he a formalized statement of the fifth 
Peano postulate. 

To express that rule, we need a little notation. Let us abbreviate a well-formed 
formula in which the variable a is free by the following notation: 


(There may be other free variables, too, but that is irrelevant.) Then the notation X{Sa/a} 
will stand for that string but with every occurrence of a replaced by Sa. Likewise, X{0/a} 
would stand for the same string, with each appearance of a replaced by 0. 

A specific example would be to let X{a} stand for the string in question: (0+a)=a. 
Then X{Sa/a} would represent the string (0+Sa)=Sa, and X{0/a} would represent 
(0+0)=0. (Warning: This notation is not part of TNT; it is for our convenience in talking 
about TNT.) 

With this new notation, we can state the last rule of TNT quite precisely: 

RULE OF INDUCTION: Suppose u is a variable, and X{u} is a well-formed formula in 
which u occurs free. If both ¥u:< X{u}=> X{Su/u}> and X{0/u} are theorems, 
then ¥u: X{u} is also a theorem. 

This is about as close as we can come to putting Peano's fifth postulate into TNT. Now 
let us use it to show that Va:(0+a)=a is indeed a theorem in TNT. Emerging from the 
fantasy in our derivation above, we can apply the fantasy rule, to give us 

(10) <(0+b)=b3(0+Sb)=Sb> fantasy rule 

(11) ¥b:<(0+b)=b^(0+Sb)=Sb> generalization 

Typographical Number Theory 


This is the first of the two input theorems required by the induction The other 
requirement is the first line of the pyramid, which we have. Therefore, we can apply the 
rule of induction, to deduce what we wanted. 


Specification and generalization will allow us to change the variable from b to a; thus 
¥a:(0+a)=a is no longer an undecidable string of TNT.. 

A Long Derivation 

Now I wish to present one longer derivation in TNT, so that you ca what one is like, and 
also because it proves a significant, if simple, fact of number theory. 













(16) ] 

( 1 7) <¥d: (d+5c)=(Sd+c)3¥d: (d+SSc)=(Sd+Sc)> 

(18) ¥c:<^d:(d+Sc)=(Sd+c) 3¥d:(d+SSc)=(Sd+Sc)> 









axiom 3 



specification (line 1) 







carry over 3 


carry over 6 




fantasy rule 

(19) (d+S0)=5(d+0) 

(20) ¥a:(a+0)=a 

(21) (d+0)=d 

(22) S(d+0)=Sd 

(23) (d+SO)=Sd 

(24) (Sd+0)=Sd 

(25) Sd=(Sd+0) 

specification (line 2) 
axiom 1 

transitivity (lines 19,2) 
specification (line 20) 

Typographical Number Theory 


(26) (d+SO)=(Sd+o) 

(27) ¥d:(d+50)=(Sd+0) 

transitivity (lines 23,25) 

(28) ¥c:^d:(d+Sc)=(Sd+c) induction (lines 1 8,27) 

[S can be slipped back and forth in an addition] 

(29) ¥b:(c+Sb)=S(c+b) 

specification (line 1) 

(30) (c+Sd)=S(c+d) 


(31) ¥b:(d+Sb)=S(d+b) 

specification (line 1) 

(32) (d+Sc)=S(d+c) 


(33) S(d+c)=(d+Sc) 


(34) bed:(d+Sc)=(Sd+c) 

specification (line 28) 

(35) (d+Sc)=(Sd+c) 



(36) [ 


(37) ¥c:(c+d)=(d+c) 


(38) (c+d)=(d+c) 


(39) S(c+d)=S(d+c) 


(40) (c+Sd)=S(c+d) 

carry over 30 

(41) (c+Sd)=S(d+c) 


(42) S(d+c)=(d+Sc) 

carry over 33 

(43) (c+Sd)=(d+Sc) 


(44) (d+Sc)=(Sd+c) 

carry over 35 

(45) (c+Sd)=(Sd+c) 


(46) ¥c:(c+Sd)=(Sd+c) 


(47) ] 


(48) <¥e:(c+d)=(d+c) =D¥c:(c+Sd)=(Sd+c)> 

fantasy rule 

(49) ¥d:<^Vc:(c+d)=(d+c) 3¥c:(c+Sd)=(Sd+c)> 


[If d commutes with every c, then Sd does too. 

(50) (c+0)=c 

specification (line 20) 


previous theorem 

(52) (0+c)=c 


(53) c=(0+c) 


Typographical Number Theory 


(54) (c+0)=(0+c) 

(55) ¥c:(c+0)=(O+c) 

transitivity (lines 50,53) 

[0 commutes with every c] 

(56) ¥d:^c:(c+d)=(d+c) 

induction (lines 49,55) 

[Therefore, every d commutes with every c] 

Tension and Resolution in TNT 

TNT has proven the commutativity of addition. Even if you do not follow this derivation 
in detail, it is important to realize that, like a piece of music, it has its own natural 
"rhythm". It is not just a random walk that happens to have landed on the desired last 
line. I have inserted "breathing marks" to show some of the "phrasing" of this derivation. 
Line 28 in particular turning point in the derivation, something like the halfway point it 
AABB type of piece, where you resolve momentarily, even if not in the t key. Such 
important intermediate stages are often called "lemmas". 

It is easy to imagine a reader starting at line 1 of this derivation ignorant of where 
it is to end up, and getting a sense of where it is going as he sees each new line. This 
would set up an inner tension, very much the tension in a piece of music caused by chord 
progressions that let know what the tonality is, without resolving. Arrival at line 28 w, 
confirm the reader's intuition and give him a momentary feeling of satisfaction while at 
the same time strengthening his drive to progress tow what he presumes is the true goal. 

Now line 49 is a critically important tension-increaser, because of "almost-there" 
feeling which it induces. It would be extremely unsatisfactory to leave off there! From 
there on, it is almost predictable how things must go. But you wouldn't want a piece of 
music to quit on you just when had made the mode of resolution apparent. You don't 
want to imagine ending-you want to hear the ending. Likewise here, we have to c things 
through. Line 55 is inevitable, and sets up all the final tension which are resolved by Line 

This is typical of the structure not only of formal derivations, but of informal 
proofs. The mathematician's sense of tension is intimately related to his sense of beauty, 
and is what makes mathematics worthy doing. Notice, however, that in TNT itself, there 
seems to be no reflection of these tensions. In other words, TNT doesn't formalize the 
notions of tension and resolution, goal and subgoal, "naturalness" and "inevitable any 
more than a piece of music is a book about harmony and rhythm. Could one devise a 
much fancier typographical system which is aware of the tensions and goals inside 


Typographical Number Theory 


Formal Reasoning vs. Informal Reasoning 

I would have preferred to show how to derive Euclid's Theorem (the infinitude of 
primes) in TNT, but it would probably have doubled the length of the book. Now after 
this theorem, the natural direction to go would be to prove the associativity of addition, 
the commutativity and associativity of multiplication and the distributivity of 
multiplication over addition. These would give a powerful base to work from. 

As it is now formulated, TNT has reached "critical mass" (perhaps a strange 
metaphor to apply to something called "TNT"). It is of the same strength as the system of 
Principia Mathematica; in TNT one can now prove every theorem which you would find 
in a standard treatise on number theory. Of course, no one would claim that deriving 
theorems in TNT is the best way to do number theory. Anybody who felt that way would 
fall in the same class of people as those who think that the best way to know what 1000 x 
1000 is, is to draw a 1000 by 1000 grid, and count all the squares in it ... No; after total 
formalization, the only way to go is towards relaxation of the formal system. Otherwise, 
it is so enormously unwieldy as to be, for all practical purposes, useless. Thus, it is 
important to embed TNT within a wider context, a context which enables new rules of 
inference to be derived, so that derivations can be speeded up. This would require 
formalization of the language in which rules of inference are expressed-that is, the 
metalanguage. And one could go considerably further. However, none of these speeding- 
up tricks would make TNT any more powerful; they would simply make it more usable. 
The simple fact is that we have put into TNT every mode of thought that number 
theorists rely on. Embedding it in ever larger contexts will not enlarge the space of 
theorems; it will just make working in TNT-or in each "new, improved version" -look 
more like doing conventional number theory. 

Number Theorists Go out of Business 

Suppose that you didn't have advance knowledge that TNT will turn out to be 
incomplete, but rather, expected that it is complete-that is, that every true statement 
expressible in the TNT-notation is a theorem. In that case, you could make a decision 
procedure for all of number theory. The method would be easy: if you want to know if N- 
statement X is true or false, code it into TNT-sentence x. Now if X is true, completeness 
says that x is a theorem; and conversely, if not-X is true, then completeness says that ~x 
is a theorem. So either x or ~x must be a theorem, since either X or not-X is true. Now 
begin systematically enumerating all the theorems of TNT, in the way we did for the 
MlU-system and pq-system. You must come to x or ~x after a while; and whichever one 
you hit tells you which of X and not-X is true. (Did you follow this argument? It crucially 
depends on your being able to hold separate in your mind the formal system TNT and its 
informal counterpart N. Make sure you understand it.) Thus, in prince- 

Typographical Number Theory 


pie, if TNT were complete, number theorists would be put out of business any question 
in their field could be resolved, with sufficient time, in a purely mechanical way. As it 
turns out, this is impossible, which, depending on your point of view, is a cause either for 
rejoicing, or for mourning. 

Hilbert's Program 

The final question which we will take up in this Chapter is whether should have 
as much faith in the consistency of TNT as we did consistency of the Propositional 
Calculus; and, if we don't, whether possible to increase our faith in TNT, by proving it to 
be consistent could make the same opening statement on the "obviousness" of TNT's 
consistency as Imprudence did in regard to the Propositional Calculus namely, that each 
rule embodies a reasoning principle which we believe in, and therefore to question the 
consistency of TNT is to question our own sanity. To some extent, this argument still 
carries weight-but not quite so much weight as before. There are just too many rules of 
inference and some of them just might be slightly "off ". Furthermore, how do we know 
that this mental model we have of some abstract entities called "natural numbers" is 
actually a coherent construct? Perhaps our own thought processes, those informal 
processes which we have tried to capture in the formal rules of the system, are themselves 
inconsistent! It is of course not the kind of thing we expect, but it gets more and more 
conceivable that our thoughts might lead us astray, the more complex the subject matter 
gets-and natural numbers are by no means a trivial subject matter. Prudence's cry for a 
proof of consistency has to be taken more seriously in this case. It's not that we seriously 
doubt that TNT could be inconsistent but there is a little doubt, a flicker, a glimmer of a 
doubt in our minds, and a proof would help to dispel that doubt. 

But what means of proof would we like to see used? Once again, faced with the 
recurrent question of circularity. If we use all the equipment in a proof about our system 
as we have inserted into it, what will we have accomplished? If we could manage to 
convince ourselves consistency of TNT, but by using a weaker system of reasoning than 
we will have beaten the circularity objection! Think of the way a heavy rope is passed 
between ships (or so I read when I was a kid): first a light arrow is fired across the gap, 
pulling behind it a thin rope. Once a connection has been established between the two 
ships this way, then the heavy rope pulled across the gap. If we can use a "light" system 
to show that a system is consistent, then we shall have really accomplished something. 

Now on first sight one might think there is a thin rope. Our goal is to prove that 
TNT has a certain typographical property (consistency): that no theorems of the form x 
and .~x ever occur. This is similar to trying to show that MU is not a theorem of the 
MlU-system. Both are statements about typographical properties of symbol- 
manipulation systems. The visions of a thin rope are based on the presumption that facts 
about number theory won 't be 

Typographical Number Theory 


needed in proving that such a typographical property holds. In other words, if properties 
of integers are not used-or if only a few extremely simple ones are used-then we could 
achieve the goal of proving TNT consistent, by using means which are weaker than its 
own internal modes of reasoning. 

This is the hope which was held by an important school of mathematicians and 
logicians in the early part of this century, led by David Hilbert. The goal was to prove the 
consistency of formalizations of number theory similar to TNT by employing a very 
restricted set of principles of reasoning called "finitistic" methods of reasoning. These 
would be the thin rope. Included among finitistic methods are all of propositional 
reasoning, as embodied in the Propositional Calculus, and additionally some kinds of 
numerical reasoning. But Godel's work showed that any effort to pull the heavy rope of 
TNT's consistency across the gap by using the thin rope of finitistic methods is doomed 
to failure. Godel showed that in order to pull the heavy rope across the gap, you can't use 
a lighter rope; there just isn't a strong enough one. Less metaphorically, we can say: Any 
system that is strong enough to prove TNT's consistency is at least as strong as TNT 
itself. And so circularity is inevitable. 

Typographical Number Theory 


A Mu Offering 

The Tortoise and Achilles have just been to hear a lecture on the origins of the 
Genetic Code, and are now drinking some tea at Achilles' home. 

Achilles: I have something terrible to confess, Mr. T. 
Tortoise: What is it, Achilles? 

Achilles: Despite the fascinating subject matter of that lecture, I drifter to sleep a time or 
two. But in my drowsy state, I still was semi-awake aware of the words coming into 
my ears. One strange image that floated up from my lower levels was that "A' and T', 
instead of standing "adenine" and "thymine", stood for my name and yours-and 
double-strands of DNA had tiny copies of me and you along backbones, always 
paired up, just as adenine and thymine always Isn't that a strange symbolic image? 

Tortoise: Phooey! Who believes in that silly kind of stuff? Anyway, about 'C and 'G? 

Achilles: Well, I suppose C could stand for Mr. Crab, instead o cytosine. I'm not sure 
about G', but I'm sure one could thin something. Anyway, it was amusing to imagine 
my DNA being with minuscule copies of you-as well as tiny copies of myself, for 
matter. Just think of the infinite regress THAT leads to ! 

Tortoise: I can see you were not paying too much attention to the lecture. 

Achilles: No, you're wrong. I was doing my best, only I had a hard keeping fancy 
separated from fact. After all, it is such a strange netherworld that those molecular 
biologists are exploring. 

Tortoise: How do you mean? 

Achilles: Molecular biology is filled with peculiar convoluted loops which I can't quite 
understand, such as the way that folded proteins, which are coded for in DNA, can 
loop back and manipulate the DNA which came from, possibly even destroying it. 
Such strange loops always confuse the daylights out of me. They're eerie, in a way. 

Tortoise: I find them quite appealing. 

Achilles: You would, of course-they're just down your alley. But me, sometimes I like to 
retreat from all this analytic thought any meditate a little, as an antidote. It clears my 
mind of all those conf loops and incredible complexities which we were hearing about 

Tortoise: Fancy that. I wouldn't have guessed that you were a meditator 
Achilles: Did I never tell you that I am studying Zen Buddhism? 
Tortoise: Heavens, how did you come upon that? 
Achilles: I have always had a yen for the yin and yang, you know - the 

A Mu Offering 


whole Oriental mysticism trip, with the I Ching, gurus, and whatnot. So one day I'm 
thinking to myself, "Why not Zen too?" And that's how it all began. 

Tortoise: Oh, splendid. Then perhaps I can finally become enlightened. Achilles: Whoa, 
now. Enlightenment is not the first step on the road to Zen; if anything, it', the last 
one! Enlightenment is not for novices like you, Mr. T! 

Tortoise: I see we have had a misunderstanding. By "enlightenment", I hardly meant 
something so weighty as is meant in Zen. All I meant is that I can perhaps become 
enlightened as to what Zen is all about. Achilles: For Pete's sake, why didn't you say 
so? Well, I'd be only too happy to tell you what I know of Zen. Perhaps you might 
even be tempted to become a student of it, like me. 

Tortoise: Well, nothing's impossible. 

Achilles: You could study with me under my master, Okanisama-the seventh patriarch. 

Tortoise: Now what in the world does that mean? 

Achilles: You have to know the history of Zen to understand that. 

Tortoise: Would you tell me a little of the history of Zen, then? 

Achilles: An excellent idea. Zen is a kind of Buddhism which was founded by a monk 
named Bodhidharma, who left India and went to China around the sixth century. 
Bodhidharma was the first patriarch. The sixth one was Eno. (I've finally got it 
straight now!) 

Tortoise: The sixth patriarch was Zeno, eh? I find it strange that he, of all people, would 

get mixed up in this business. 
Achilles: I daresay you underestimate the value of Zen. Listen just a little more, and 

maybe you'll come to appreciate it. As I was saying, about five hundred years later, 

Zen was brought to Japan, and it took hold very well there. Since that time it has been 

one of the principal religions in Japan. 
Tortoise: Who is this Okanisama, the "seventh patriarch"? 

Achilles: He is my master, and his teachings descend directly from those of the sixth 
patriarch. He has taught me that reality is one, immutable, and unchanging; all 
plurality, change, and motion are mere illusions of the senses. 

Tortoise: Sure enough, that's Zeno, a mile away. But how ever did he come to be tangled 
up in Zen? Poor fellow! 

Achilles: Whaaat? I wouldn't put it that way. If ANYONE is tangled up, it's ... But that's 
another matter. Anyway, I don't know the answer to your question. Instead, let me tell 
you something of the teachings of my master. I have learned that in Zen, one seeks 
enlightenment, or SATORI-the state of "No-mind". In this state, one does not think 
about the world-one just is. I have also learned that a student of Zen is not supposed 
to "attach" to any object or thought or person-which is to say, he must not believe in, 
or depend on, any absolute-not even this philosophy of nonattachment. 

A Mu Offering 


Tortoise: Hmm ... Now THERE'S something I could like about Achilles: I had a hunch 
you'd get attached to it. 

Tortoise: But tell me: if Zen rejects intellectual activity, does it make sense to 
intellectualize about Zen, to study it rigorously? 

Achilles: That matter has troubled me quite a bit. But I think I have finally worked out an 
answer. It seems to me that you may begin approaching Zen through any path you 
know-even if it is completely antithetical to Zen. As you approach it, you gradually 
learn to stray from that path. The more you stray from the path, the closer you get to 

Tortoise: Oh, it all begins to sound so clear now. 

Achilles: My favorite path to Zen is through the short, fascinating and weird Zen parables 

called "koans". 
Tortoise: What is a koan? 

Achilles: A koan is a story about Zen masters and their student times it is like a riddle; 

other times like a fable; and other ti nothing you've ever heard before. 
Tortoise: Sounds rather intriguing. Would you say that to read al koans is to practice 


Achilles: I doubt it. However, in my opinion, a delight in koans million times closer to 

real Zen than reading volume after about Zen, written in heavy philosophical jargon. 
Tortoise: I would like to hear a koan or two. 

Achilles: And I would like to tell you one-or a few. Perhaps begin with the most famous 
one of all. Many centuries ago, the Zen master named Joshu, who lived to be 119 
years old. 

Tortoise: A mere youngster! 

Achilles: By your standards, yes. Now one day while Joshu and monk were standing 
together in the monastery, a dog wand The monk asked Joshu, "Does a dog have 

Tortoise: Whatever that is. So tell me -what did Joshu reply? 

Achilles: 'MU'. 

Tortoise: 'MU? What is this 'MU'? What about the dog? What about Buddha-nature? 
What's the answer? 

Achilles: Oh, but 'MU' is Joshu's answer. By saying 'MU', Joshu let the other monk know 

that only by not asking such questions can one know the answer to them. 
Tortoise: Joshu "unasked" the question. 
Achilles: Exactly! 

Tortoise: 'MU' sounds like a handy thing to have around. I'd like unask a question or two, 
sometimes. I guess I'm beginning to get the hang of Zen. Do you know any other 
koans, Achilles? I would like to hear some more. 

Achilles: My pleasure. I can tell you a pair of koans which go together 
Only ... 

Tortoise: What's the matter? 

A Mu Offering 


Achilles: Well, there is one problem. Although both are widely told koans, my master has 
cautioned me that only one of them is genuine. And what is more, he does not know 
which one is genuine, and which one is a fraud. 

Tortoise: Crazy! Why don't you tell them both to me and we can speculate to our hearts' 

Achilles: All right. One of the alleged koans goes like this: 

A monk asked Baso: "What is Buddha?" 
Baso said: "This mind is Buddha." 

Tortoise: Hmm ... "This mind is Buddha"? Sometimes I don't quite understand what these 

Zen people are getting at. Achilles: You might prefer the other alleged koan then. 
Tortoise: How does it run? Achilles: Like this: 

A monk asked Baso: "What is Buddha?" 
Baso said: "This mind is not Buddha." 

Tortoise: My, my! If my shell isn't green and not green! I like that! Achilles: Now, Mr. T- 

you're not supposed to just "like" koans. 
Tortoise: Very well, then-I don't like it. 

Achilles: That's better. Now as I was saying, my master believes only one of the two is 

Tortoise: I can't imagine what led him to such a belief. But anyway, I suppose it's all 

academic, since there's no way to know if a koan is genuine or phony. 
Achilles: Oh, but there you are mistaken. My master has shown us how to do it. 
Tortoise: Is that so? A decision procedure for genuineness of koans? I should very much 

like to hear about THAT. 
Achilles: It is a fairly complex ritual, involving two stages. In the first stage, you must 

TRANSLATE the koan in question into a piece of string, folded all around in three 


Tortoise: That's a curious thing to do. And what is the second stage? 

Achilles: Oh, that's easy-all you need to do is determine whether the string has Buddha- 
nature, or not! If it does, then the koan is genuine-if not, the koan is a fraud. 

Tortoise: Hmm ... It sounds as if all you've done is transfer the need for a decision 
procedure to another domain. Now it's a decision procedure for Buddha-nature that 
you need. What next? After all, if you can't even tell whether a Do(; has Buddha- 
nature or not, how can you expect to do so for every possible folded string? 

Achilles: Well, my master explained to me that shifting between domains can help. It's 
like switching your point of view. Things sometimes look complicated from one 
angle, but simple from another. He gave the example of an orchard, in which from 
one direction no order is 

A Mu Offering 


FIGURE 45. La Mezquita, by M. C. Escher (black and white chalk, 1936 

apparent, but from special angles, beautiful regularity em, You've reordered the same 

information by changing your way of looking at it. 
Tortoise: I see. So perhaps the genuineness of a koan is concealed how very deeply inside 

it, but if you translate it into a string it ma in some way to float to the surface? 
Achilles: That's what my master has discovered. 

Tortoise: Then I would very much like to learn about the techniqu first, tell me: how can 
you turn a koan (a sequence of words) folded string (a three-dimensional object)? 
They are rather dif kinds of entities. 

Achilles: That is one of the most mysterious things I have learned i There are two steps: 
"transcription" and "translation". TRANSCF a koan involves writing it in a phonetic 
alphabet, which contain four geometric symbols. This phonetic rendition of the koan 
is called the MESSENGER. 

Tortoise: What do the geometric symbols look like? 

Achilles: They are made of hexagons and pentagons. Here is what they 

A Mu Offering 


look like (picks up a nearby napkin, and draws for the Tortoise these four figures): 


Tortoise: They are mysterious-looking. 

Achilles: Only to the uninitiated. Now once you have made the messenger, you rub your 

hands in some ribo, and 
Tortoise: Some ribo? Is that a kind of ritual anointment? 

Achilles: Not exactly. It is a special sticky preparation which makes the string hold its 
shape, when folded up. Tortoise: What is it made of? 

Achilles: I don't know, exactly. But it feels sort of gluey, and it works exceedingly well. 
Anyway, once you have some ribo on your hands, you can TRANSLATE the 
sequence of symbols in the messenger into certain kinds of folds in the string. It's as 
simple as that. Tortoise: Hold on! Not so fast! How do you do that? 

Achilles: You begin with the string entirely straight. Then you go to one end and start 
making folds of various types, according to the geometric symbols in the messenger. 

Tortoise: So each of those geometric symbols stands for a different way to curl the string 

Achilles: Not in isolation. You take them three at a time, instead of one at a time. You 
begin at one end of the string, and one end of the messenger. What to do with the first 
inch of the string is determined by the first three geometric symbols. The next three 
symbols tell you how to fold the second inch of string. And so you inch your way 
along the string and simultaneously along the messenger, folding each little segment 
of string until you have exhausted the messenger. If you have properly applied some 
ribo, the string will keep its folded shape, and what you thereby produce is the 
translation of the koan into a string. 

Tortoise: The procedure has a certain elegance to it. You must get some wild-looking 
strings that way. 

Achilles: That's for sure. The longer koans translate into quite bizarre shapes. 

Tortoise: I can imagine. But in order to carry out the translation of the messenger into the 
string, you need to know what kind of fold each triplet of geometric symbols in the 
messenger stands for. How do you know this? Do you have a dictionary? 

Achilles: Yes-there is a venerated book which lists the "Geometric Code". If you don't 
have a copy of this book, of course, you can't translate a koan into a string. 

A Mu Offering 


Tortoise: Evidently not. What is the origin of the Geometric Code Achilles: It came from 

an ancient master known as "Great Tutor" who my master says is the only one ever to 

attain the Enlightenment ' Enlightenment. 
Tortoise: Good gravy! As if one level of the stuff weren't enough. But then there are 

gluttons of every sort- why not gluttons for enlighten] Achilles: Do you suppose that 

"Enlightenment 'Yond Enlighten] stands for "EYE"? 
Tortoise: In my opinion, it's rather doubtful that it stands for you, Ac More likely, it 

stands for "Meta-Enlightenment"-"ME", that is 
Achilles: For you? Why would it stand for you? You haven't even re; the FIRST stage of 

enlightenment, let alone the 
Tortoise: You never know, Achilles. Perhaps those who have learn( lowdown on 

enlightenment return to their state before enlighten I've always held that "twice 

enlightened is unenlightened." But le back to the Grand Tortue-uh, I mean the Great 


Achilles: Little is known of him, except that he also invented the Art of Zen Strings. 
Tortoise: What is that? 

Achilles: It is an art on which the decision procedure for Buddha-nature is based. I shall 
tell you about it. 

Tortoise: I would be fascinated. There is so much for novices like absorb! 

Achilles: There is even reputed to be a koan which tells how the Art Strings began. But 

unfortunately, all this has long since been lost sands of time, and is no doubt gone 

forever. Which may be just a for otherwise there would be imitators who would take 

on the m~ name, and copy him in other ways. 
Tortoise: But wouldn't it be a good thing if all students of Zen copied that most 

enlightened master of all, the Great Tutor? 
Achilles: Let me tell you a koan about an imitator. 

Zen master Gutei raised his finger whenever he was asked a question about Zen. A 
young novice began to irritate him in this way. When Gut was told about the 
novice's imitation, he sent for him and asked him if were true. The novice 
admitted it was so. Gutei asked him if he understood. In reply the novice held up 
his index finger. Gutei promptly cut off. The novice ran from the room, howling in 
pain. As he reached it threshold, Gutei called, "Boy!" When the novice turned, 
Gutei raised h index finger. At that instant the novice vas enlightened. 

Tortoise: Well, what do you know! Just when I thought Zen was all about Joshu and his 
shenanigans, now I find out that Gutei is in on the merriment too. He seems to have 
quite a sense of humor. 

Achilles: That koan is very serious. I don't know how you got the idea that it is 

Tortoise: Perhaps Zen is instructive because it is humorous. I would guess 

A Mu Offering 


that if you took all such stories entirely seriously, you would miss the point as often as 
you would get it. 
Achilles: Maybe there's something to your Tortoise-Zen. 

Tortoise: Can you answer just one question for me? I would like to know this: Why did 

Bodhidharma come from India into China? 
Achilles: Oho! Shall I tell you what Joshu said when he was asked that very question? 
Tortoise: Please do. 

Achilles: He replied, "That oak tree in the garden." 

Tortoise: Of course; that's just what I would have said. Except that I would have said it in 
answer to a different question-namely, "Where can I find some shade from the 
midday sun?" 

Achilles: Without knowing it, you have inadvertently hit upon one of the basic questions 
of all Zen. That question, innocent though it sounds, actually means, "What is the 
basic principle of Zen?" 

Tortoise: How extraordinary. I hadn't the slightest idea that the central aim of Zen was to 
find some shade. 

Achilles: Oh, no-you've misunderstood me entirely. I wasn't referring to THAT question. 

I meant your question about why Bodhidharma came from India into China. 
Tortoise: I see. Well, I had no idea that I was getting into such deep waters. But let's 

come back to this curious mapping. I gather that any koan can be turned into a folded 

string by following the method you outlined. Now what about the reverse process? 

Can any folded string be read in such a way as to yield a koan? 
Achilles: Well, in a way. However .. . 
Tortoise: What's wrong? 

Achilles: You're just not supposed to do it that way 'round. It would violate the Central 
Dogma of Zen strings, you see, which is contained in this picture {picks up a napkin 
and draws): 

koan => messenger folded string 
transcription translation 

You're not supposed to go against the arrows-especially not the second one. 
Tortoise: Tell me, does this Dogma have Buddha-nature, or not? Come to think of it, I 

think I'll unask the question. Is that all right? 
Achilles: I am glad you unasked the question. But-I'll let you in on a secret. Promise you 

won't tell anyone? 
Tortoise: Tortoise's honor. 

Achilles: Well, once in a while, I actually do go against the arrows. I get sort of an illicit 

thrill out of it, I guess. 
Tortoise: Why, Achilles! I had no idea you would do something so irreverent! 
Achilles: I've never confessed it to anyone before -not even Okanisama. 

A Mu Offering 


Tortoise: So tell me, what happens when you go against the arrows i Central Dogma? 

Does that mean you begin with a string and m koan? 
Achilles: Sometimes-but some weirder things can happen. 
Tortoise: Weirder than producing koans? 

Achilles: Yes ... When you untranslate and untranscribe, you get THING, but not always 

a koan. Some strings, when read out Ion way, only give nonsense. 
Tortoise: Isn't that just another name for koans? 
Achilles: You clearly don't have the true spirit of Zen yet. 
Tortoise: Do you always get stories, at least? 

Achilles: Not always-sometimes you get nonsense syllables, other you get ungrammatical 

sentences. But once in a while you get seems to be a koan. 
Tortoise: It only SEEMS to be one? 
Achilles: Well, it might be fraudulent, you see. 
Tortoise: Oh, of course. 

Achilles: I call those strings which yield apparent koans "well-foi strings. 

Tortoise: Why don't you tell me about the decision procedure which allows you to 

distinguish phony koans from the genuine article? 
Achilles: That's what I was heading towards. Given the koan, or non» as the case may be, 

the first thing is to translate it into the dimensional string. All that's left is to find out 

if the strip Buddha-nature or not. 
Tortoise: But how do you do THAT? 

Achilles: Well, my master has said that the Great Tutor was able, I glancing at a string, to 

tell if it had Buddha-nature or not. 
Tortoise: But what if you have not reached the stage of the Enlightenment: Yond 

Enlightenment? Is there no other way to tell if a string hasi Buddha-nature? 
Achilles: Yes, there is. And this is where the Art of Zen Strings come is a technique for 

making innumerably many strings, all of whit Buddha-nature. 
Tortoise: You don't say! And is there a corresponding way of n strings which DON'T 

have Buddha-nature? 
Achilles: Why would you want to do that? 
Tortoise: Oh, I just thought it might be useful. 

Achilles: You have the strangest taste. Imagine! Being more intere things that DON'T 

have Buddha-nature than things that DO! 
Tortoise: Just chalk it up to my unenlightened state. But go on. T how to make a string 

which DOES have Buddha-nature. 
Achilles: Well, you must begin by draping a loop of string over your in one of five legal 

starting positions, such as this one ... {Picks up a string and drapes it in a simple loop 

between a finger on each hand. :) 

A Mu Offering 


Tortoise: What are the other four legal starting positions? 

Achilles: Each one is a position considered to be a SELF-EVIDENT manner of picking 
up a string. Even novices often pick up strings in those positions. And these five 
strings all have Buddha-nature. Tortoise: Of course. 

Achilles: Then there are some String Manipulation Rules, by which you can make more 
complex string figures. In particular, you are allowed to modify your string by doing 
certain basic motions of the hands. For instance, you can reach across like this-and 
pull like this-and twist like this. With each operation you are changing the overall 
configuration of the string draped over your hands. 

Tortoise: Why, it looks just like making cat's-cradles and such string figures! 

Achilles: That's right. Now as you watch, you'll see that some of these rules make the 
string more complex; some simplify it. But whichever way you go, as long as you 
follow the String Manipulation Rules, every string you produce will have Buddha- 

Tortoise: That is truly marvelous. Now what about the koan concealed inside this string 
you've just made? Would it be genuine? 

Achilles: Why, according to what I've learned, it must. Since I made it according to the 
Rules, and began in one of the five self-evident positions, the string must have 
Buddha-nature, and consequently it must correspond to a genuine koan. 

Tortoise: Do you know what the koan is? 

Achilles: Are you asking me to violate the Central Dogma? Oh, you naughty fellow! 

(And with furrowed brow and code book in hand, Achilles points along the string 
inch by inch, recording each fold by a triplet of geometric symbols of the strange 
phonetic alphabet for koan, until he has nearly a napkinful.) 


Tortoise: Terrific. Now let's hear it. 
Achilles: All right. 

A traveling monk asked an old woman the road to Taizan, a popular temple 
supposed to give wisdom to the one who worships there. The old woman said: 
"Go straight ahead." After the monk had proceeded a few steps, she said to herself, 
"He also is a common church-goer." Someone told this incident to Joshu, who 
said: "Wait until I investigate." The next day he went and asked the same question, 
and the old woman gave the same answer. Joshu remarked: "I have investigated 
that old woman." 

Tortoise: Why, with his flair for investigations, it's a shame that Joshu 
never was hired by the FBI. Now tell me- what you did, I could also 
do, if I followed the Rules from the Art of Zen Strings, right? 
Achilles: Right. 

Tortoise: Now would I have to perform the operations in just the same ORDER as you 

A Mu Offering 


.Achilles: No, any old order will do. 

Tortoise: Of course, then I would get a different string, and consequently a different 

koan. Now would I have to perform the same NUMBER of steps as you did? 
Achilles: By no means. Any number of steps is fine. 

Tortoise: Well, then there are an infinite number of strings with Buddha nature-and 
consequently an infinite number of genuine koans Howdo you know there is any 
string which CAN "I- be made by your Achilles: Oh, yes-back to things which lack 
Buddha-nature. It just so happens that once you know how to make strings WITH 
Buddha nature, you can also make strings WITHOUT Buddha-nature. That is 
something which my master drilled into me right at the beg Tortoise: Wonderful! 
How does it work? 

Achilles: Easy. Here, for example -I'll make a string which lacks Buddha-nature .. . 

(He picks up the string out of which the preceding koan was "pulled", ties a little 
teeny knot at one end of it, pulling it tight with his thumb forefinger.) 

This is it — no Buddha-nature here. 

Tortoise: Very illuminating. All it takes is adding a knot? How know that the new string 
lacks Buddha-nature? 

Achilles: Because of this fundamental property of Buddha-nature; when two well-formed 
strings are identical but for a knot at one end, then only ONE of them can have 
Buddha-nature. It's a rule of thumb which my master taught me. 

Tortoise: I'm just wondering about something. Are there some strings with Buddha- 
nature which you CAN'T reach by following the Rules of Zen Strings, no matter in 
what order? 

Achilles: I hate to admit it, but I am a little confused on this point myself. At first my 
master gave the strongest impression that Buddha in a string was DEFINED by 
starting in one of the five legal positions, and then developing the string according to 
the Rules. But then later, he said something about somebody-o "Theorem". I never 
got it straight. Maybe I even misheard said. But whatever he said, it put some doubt in 
my mind as to this method hits ALL strings with Buddha-nature. To the be 
knowledge, at least, it does. But Buddha-nature is a pretty elusive thing, you know. 

Tortoise: I gathered as much, from Joshu's 'MU. I wonder ... 

Achilles: What is it? 

Tortoise: I was just wondering about those two koans-I mean t and its un-koan-the ones 
which say "This mind is Buddha" at mind is not Buddha" -what do they look like, 
when turned int via the Geometric Code? 

Achilles: I'd be glad to show you. 

A Mu Offering 


(He writes down the phonetic transcriptions, and then pulls from his pocket a 
couple of pieces of string, which he carefully folds inch by inch, following the 
triplets of symbols written in the strange alphabet. Then he places the finished 
strings side by side.) 

You see, here is the difference. 

Tortoise: They are very similar, indeed. Why, I do believe there is only one difference 

between them: it's that one of them has a little knot on its end! 
Achilles: By Joshu, you're right. 

Tortoise: Aha! Now I understand why your master is suspicious. 
Achilles: You do? 

Tortoise: According to your rule of thumb, AT MOST ONE of such a pair can have 
Buddha-nature, so you know right away that one of the koans must be phony. 

Achilles: But that doesn't tell which one is phony. I've worked, and so has my master, at 
trying to produce these two strings by following the String Manipulation Rules, but to 
no avail. Neither one ever turns up. It's quite frustrating. Sometimes you begin to 
wonder ... 

Tortoise: You mean, to wonder if either one has Buddha-nature? Perhaps neither of them 

has Buddha-nature-and neither koan is genuine! 
Achilles: I never carried my thoughts as far as that-but you're right-it's possible, I guess. 

But I think you should not ask so many questions about Buddha-nature. The Zen 

master Mumon always warned his pupils of the danger of too many questions. 
Tortoise: All right-no more questions. Instead, I have a sort of hankering to make a string 

myself. It would be amusing to see if what I come up with is well-formed or not. 
Achilles: That could be interesting. Here's a piece of string. (He passes one to the 


Tortoise: Now you realize that I don't have the slightest idea what to do. 

We'll just have to take potluck with my awkward production, which will follow no rules 
and will probably wind up being completely undecipherable. {Grasps the loop 
between his feet and, with a few simple manipulations, creates a complex string which 
he proffers wordlessly to Achilles. At that moment, Achilles' face lights up.) 

Achilles: Jeepers creepers! I'll have to try out your method myself. I have never seen a 
string like this! 

Tortoise: I hope it is well-formed. Achilles: I see it's got a knot at one end. 
Tortoise: Oh just a moment! May I have it back? I want to do one thing to it. 
Achilles: Why, certainly. Here you are. 

(Hands it back to the Tortoise, who ties another knot at the same end. Then the 
Tortoise gives a sharp tug, and suddenly both knots disappear!) 

A Mu Offering 


Achilles: What happened? 

Tortoise: I wanted to get rid of that knot. 

Achilles: But instead of untying it, you tied another one, and then BOTH disappeared! 

Where did they go? 
Tortoise: Tumbolia, of course. That's the Law of Double Nodulation 

(Suddenly, the two knots reappear from out of nowhere-that is to say, Tumbolia.) 

Achilles: Amazing. They must lie in a fairly accessible layer of Tumbol they can pop into 
it and out of it so easily. Or is all of Tumbolia equally inaccessible? 

Tortoise: I couldn't say. However, it does occur to me that burning string would make it 
quite improbable for the knots to come back such a case, you could think of them as 
being trapped in a deeper la of Tumbolia. Perhaps there are layers and layers of 
Tumbolia. that's neither here nor there. What I would like to know is how string 
sounds, if you turn it back into phonetic symbols. (As he hauls it back, once again, the 
knots pop into oblivion.) 

Achilles: I always feel so guilty about violating the Central Dogma (Takes out his pen 
and code book, and carefully jots down the many sym triplets which correspond to the 
curvy involutions of the Tortoise's string; when he is finished, he clears his voice.) 
Ahem. Are you ready to hear w you have wrought? 

Tortoise: I'm willing if you're willing. 

Achilles: All right. It goes like this: 

A certain monk had a habit of pestering the Grand Tortue (the only one who had ever 
reached the Enlightenment 'Yond Enlightenment), by asking whether various objects 
had Buddha-nature or not. To such questions Tortue invariably sat silent. The monk 
had already asked about a bean, a lake, and a moonlit night. One day, he brought to 
Tortue a piece of string, and asked the same question. In reply, the Grand Tortue 
grasped the loop between his feet and 

Tortoise: Between his feet? How odd! Achilles: Why should you find that odd? 

Tortoise: Well, ah ... you've got a point there. But please go on! 

Achilles: All right. 

The Grand Tortue grasped the loop between his feet and, with a few simple 
manipulations, created a complex string which he proffered wordlessly to the 
monk. At that moment, the monk was enlightened. 

Tortoise: I'd rather be twice-enlightened, personally. 

Achilles: Then it tells how to make the Grand Tortue's string, if you be, with a string 
draped over your feet. I'll skip those boring details concludes this way: 

From then on, the monk did not bother Tortue. Instead, he made string after string 
by Tortue's method; and he passed the method on to his own disciples, who passed 
it on to theirs. 

A Mu Offering 


Tortoise: Quite a yarn. It's hard to believe it was really hidden inside my string. 
Achilles: Yet it was. Astonishingly, you seem to have created a well-formed string right 
off the bat. 

Tortoise: But what did the Grand Tortue's string look like? That's the main point of this 
koan, I'd suppose. 

Achilles: I doubt it. One shouldn't "attach" to small details like that inside koans. It's the 
spirit of the whole koan that counts, not little parts of it. Say, do you know what I just 
realized? I think, crazy though it sounds, that you may have hit upon that long-lost 
koan which describes the very origin of the Art of Zen Strings! 

Tortoise: Oh, that would almost be too good to have Buddha-nature. 

Achilles: But that means that the great master- the only one who ever reached the mystical 
state of the Enlightenment 'Yond Enlightenment-was named "Tortue", not "Tutor". 
What a droll name! 

Tortoise: I don't agree. I think it's a handsome name. I still want to know how Tortue's 
string looked. Can you possibly recreate it from the description given in the koan? 

Achilles: I could try ... Of course, I'll have to use my feet, too, since it's described in 
terms of foot motions. That's pretty unusual. But I think I can manage it. Let me give 
it a go. {He picks up the koan and a piece of string, and for a few minutes twists and 
bends the string in arcane ways until he has the finished product) Well, here it is. 
Odd, how familiar it looks. 

Tortoise: Yes, isn't that so? I wonder where I saw it before? Achilles: I know! Why, this 
is YOUR string, Mr. T! Or is Tortoise: Certainly not. 

Achilles: Of course not-it's the string which you first handed to me, before you took it 
back to tie an extra knot in it. 

Tortoise: Oh, yes-indeed it is. Fancy that. I wonder what that implies. 

Achilles: It's strange, to say the least. 

Tortoise: Do you suppose my koan is genuine? 

Achilles: Wait just a moment ... 

Tortoise: Or that my string has Buddha-nature? 

Achilles: Something about your string is beginning, to trouble me, Mr.Tortoise . 
Tortoise {looking most pleased with himself and paying no attention to Achilles): And 

what about Tortue's string? Does it have Buddha nature? There are a host of questions 

to ask! 

Achilles: I would be scared to ask such questions, Mr. T. There is something mighty 
funny going on here, and I'm not sure I like it. Tortoise: I'm sorry to hear it. I can't 
imagine what's troubling you. Achilles: Well, the best way I know to explain it is to 
quote the words of another old Zen master, Kyogen. 

A Mu Offering 


Kyogen said: Zen is like a man hanging in a tree by his teeth over a precipice. His 
har grasp no branch, his feet rest on no limb, and under the tree anotl person asks 
him: "Why did Bodhidharma come to China from India?" the man in the tree does 
not answer, he fails; and if he does answer, falls and loses his life. Now what shall 
he do? 

Tortoise: That's clear; he should give up Zen, and take up molecular biology. 

A Mu Offering 



Mumon and Godel 

What Is Zen? 

I'M NOT SURE I know what Zen is. In a way, I think I understand it very well; but in a 
way, I also think I can never understand it at all. Ever since my freshman English teacher 
in college read Joshu's MU out loud to our class, I have struggled with Zen aspects of 
life, and probably I will never cease doing so. To me, Zen is intellectual quicksand- 
anarchy, darkness, meaninglessness, chaos. It is tantalizing and infuriating. And yet it is 
humorous, refreshing, enticing. Zen has its own special kind of meaning, brightness, and 
clarity. I hope that in this Chapter, I can get some of this cluster of reactions across to 
you. And then, strange though it may seem, that will lead us directly to Godelian matters. 

One of the basic tenets of Zen Buddhism is that there is no way to characterize 
what Zen is. No matter what verbal space you try to enclose Zen in, it resists, and spills 
over. It might seem, then, that all efforts to explain Zen are complete wastes of time. But 
that is not the attitude of Zen masters and students. For instance, Zen koans are a central 
part of Zen study, verbal though they are. Koans are supposed to be "triggers" which, 
though they do not contain enough information in themselves to impart enlightenment, 
may possibly be sufficient to unlock the mechanisms inside one's mind that lead to 
enlightenment. But in general, the Zen attitude is that words and truth are incompatible, 
or at least that no words can capture truth. 

Zen Master Mumon 

Possibly in order to point this out in an extreme way, the monk Mumon ("No-gate"), in 
the thirteenth century, compiled forty-eight koans, following each with a commentary 
and a small "poem". This work is called "The Gateless Gate" or the Mumonkan ("No- 
gate barrier"). It is interesting to note that the lives of Mumon and Fibonacci coincided 
almost exactly: Mumon living from 1183 to 1260 in China, Fibonacci from 1180 to 1250 
in Italy. To those who would look to the Mumonkan in hopes of making sense of, or 
"understanding", the koans, the Mumonkan may come as a rude shock, for the comments 
and poems are entirely as opaque as the koans which they are supposed to clarify. Take 
this, for example:' - 

Mumon and Godel 


FIGURE 46. Three Worlds by M. C. Escher (lithograph, 1955) 

Mumon and Godel 



Hogen of Seiryo monastery was about to lecture before dinner when he noticed that the bamboo screen, 
lowered for meditation, had not been rolled up. He pointed to it. Two monks arose wordlessly from the 
audience and rolled it up. Hogen, observing the physical moment, said, "The state of the first monk is good, 
not that of the second." 

Mumon's Commentary: 

I want to ask you: which of those two monks gained and which lost? If any of you has one eye, he will see 
the failure on the teacher's part. However, I am not discussing gain and loss. 

Mumon's Poem: 

When the screen is rolled up the great sky opens, 
Yet the sky is not attuned to Zen. 
It is best to forget the great sky 
And to retire from every wind. 

Or then again, there is this one 


Goso said: "When a buffalo goes out of his enclosure to the edge of the abyss, his horns and his 
head and his hoofs all pass through, but why can't the tail also pass?" 

Mumon's Commentary: 

If anyone can open one eye at this point and say a word of Zen, he is qualified to repay 
the four gratifications, and, not only that, he can save all sentient beings under him. But if 
he cannot say such a word of Zen, he should turn back to his tail. 

Mumon's Poem: 

If the buffalo runs, he will fall into the trench; 

If he returns, he will be butchered. 

That little tail 

Is a very strange thing. 

I think you will have to admit that Mumon does not exactly clear everything up. One 
might say that the metalanguage (in which Mumon writes) is not very different from the 
object language (the language of the koan). According to some, Mumon's comments are 
intentionally idiotic, perhaps meant to show how useless it is to spend one's time in 
chattering about Zen. How ever, Mumon's comments can be taken on more than one 
level. For instance, consider this :3 


A monk asked Nansen: "Is there a teaching no master ever taught before?" 
Nansen said: "Yes, there is." 
"What is it?" asked the monk. 

Nansen replied: "It is not mind, it is not Buddha, it is not things." 

Mumon and Godel 


FIGURE 47. Dewdrop, by M. C. Escher (mezzotint, 1948). 

Mumon's Commentary: 

Old Nansen gave away his treasure-words. He must have been greatly upset 

Mumon's Poem: 

Nansen was too kind and lost his treasure. 
Truly, words have no power. 
Even though the mountain becomes the sea, 
Words cannot open another's mind. 

In this poem Mumon seems to be saying something very central to Zen, not making 
idiotic statements. Curiously, however, the poem is referential, and thus it is a comment 
not only on Nansen's words, but on its own ineffectiveness. This type of paradox is quite 
characteristic of Zen. It is an attempt to "break the mind of logic". You see this paradox 
quality in the koan, as well. Concerning Mumon's commentary, do think that Nansen was 
really so sure of his answer? Or did the "correctness of his answer matter at all? Or does 
correctness play any role in Zen? is the difference between correctness and truth, or is 
there any? What if Nansen had said, "No, there is not any such teaching"? Would it have 
r any difference? Would his remark have been immortalized in a koan? 

Mumon and Godel 


FIGURE 48. Another World, by M. C. Escher (wood-engraving, 1947). 

Here is another koan which aims to break the mind of logic:' 

The student Doko came to a Zen master, and said: "I am seeking the truth. In what state 
of mind should I train myself, so as to find it?" 

Said the master, "There is no mind, so you cannot put it in any state. There is no 
truth, so you cannot train yourself for it." 

"If there is no mind to train, and no truth_ to find, why do you have these monks 
gather before you every day to study- Zen and train themselves for this study?" 

"But I haven't an inch of room here," said the master, "so how could the monks 
gather? I have no tongue, so how could I call them together or teach them?" 

Mumon and Godel 


"Oh, how can you lie like this?" asked Doko. 

"But if I have no tongue to talk to others, how can I lie to you?" asked the master. 
Then Doko said sadly, "I cannot follow you. I cannot understand you 
"I cannot understand myself," said the master. 

If any koan serves to bewilder, this one does. And most likely, can bewilderment is its 
precise purpose, for when one is in a bewildered s one's mind does begin to operate 
nonlogically, to some extent. Only by stepping outside of logic, so the theory goes, can 
one make the lea enlightenment. But what is so bad about logic? Why does it prevent the 
to enlightenment? 

Zen's Struggle Against Dualism 

To answer that, one needs to understand something about what enlightenment is. Perhaps 
the most concise summary of enlightenment w be: transcending dualism. Now what is 
dualism? Dualism is the conceptual division of the world into categories. Is it possible to 
transcend this natural tendency? By prefixing the word "division" by the word 
"conceptual", I may have made it seem that this is an intellectual or cons effort, and 
perhaps thereby given the impression that dualism could overcome simply by suppressing 
thought (as if to suppress thinking act were simple!). But the breaking of the world into 
categories takes plat below the upper strata of thought; in fact, dualism is just as a 
perceptual division of the world into categories as it is a conceptual division In other 
words, human perception is by nature a dualistic phenomenon which makes the quest for 
enlightenment an uphill struggle, to say the least. 

At the core of dualism, according to Zen, are words just plain w The use of words 
is inherently dualistic, since each word represents, obviously, a conceptual category. 
Therefore, a major part of Zen is the against reliance on words. To combat the use of 
words, one of the devices is the koan, where words are so deeply abused that one's mi 
practically left reeling, if one takes the koans seriously. Therefore perhaps wrong to say 
that the enemy of enlightenment is logic; rather dualistic, verbal thinking. In fact, it is 
even more basic than that: perception. As soon as you perceive an object, you draw a line 
between it and the rest of the world; you divide the world, artificially, into parts you 
thereby miss the Way. 

Here is a koan which demonstrates the struggle against words: 

Shuzan held out his short staff and said: "If you call this a short staff, you oppose its 
reality. If you do not call it a short staff, you ignore the fact. N, what do you wish to call 

Mumon and Godel 


FIGURE 49. Day and Night, by M. C. Escher (woodcut, 1938). 

Mumon's Commentary: 

If you call this a short staff, you oppose its reality. If you do not call it a short staff, you 
ignore the fact. It cannot be expressed with words and it cannot be expressed without 
words. Now say quickly what it is. 

Mumon's Poem: 

Holding out the short staff, 

He gave an order of life or death. 

Positive and negative interwoven, 

Even Buddhas and patriarchs cannot escape this attack. 

("Patriarchs" refers to six venerated founders of Zen Buddhism, of whom Bodhidharma is 
the first, and Eno is the sixth.) 

Why is calling it a short staff opposing its reality? Probably because such a 
categorization gives the appearance of capturing reality, whereas the surface has not even 
been scratched by such a statement. It could be compared to saying "5 is a prime 
number". There is so much more-an infinity of facts-that has been omitted. On the other 
hand, not to call it a staff is, indeed, to ignore that particular fact, minuscule as it may be. 
Thus words lead to some truth-some falsehood, perhaps, as well-but certainly not to all 
truth. Relying on words to lead you to the truth is like relying on an incomplete formal 
system to lead you to the truth. A formal system will give you some truths, but as we 
shall soon see, a formal system-no matter how powerful-cannot lead to all truths. The 
dilemma of mathematicians is: what else is there to rely on, but formal systems? And the 
dilemma of 

Mumon and Godel 


Zen people is, what else is there to rely on, but words? Mumon states t dilemma very 
clearly: "It cannot be expressed with words and it cannot 
expressed without words." 

Here is Nansen, once again:' 

Joshu asked the teacher Nansen, "What is the true Way?" 

Nansen answered, "Everyday way is the true Way.' Joshu asked, "Can I study it?" 
Nansen answered, "The more you study, the further from the Way." Joshu asked, "If I 
don't study it, how can I know it?" 

Nansen answered, "The Way does not belong to things seen: nor to thing: unseen. It 
does not belong to things known: nor to things unknown. Do not seek it, study it, or 
name it. To find yourself on it, open yourself wide as the sky." [See Fig. 50.] 

FIGURE 50. Rind, by M. C. Escher (wood-engraving, 1955). 

Mumon and Godel 


This curious statement seems to abound with paradox. It is a little reminiscent of 
this surefire cure for hiccups: "Run around the house three times without thinking of the 
word "wolf." Zen is a philosophy which seems to have embraced the notion that the road 
to ultimate truth, like the only surefire cure for hiccups, may bristle with paradoxes. 

Ism, The Un-Mode, and Unmon 

If words are bad, and thinking is bad, what is good? Of course, to ask this is already 
horribly dualistic, but we are making no pretense of being faithful to Zen in discussing 
Zen-so we can try to answer the question seriously. I have a name for what Zen strives 
for: ism. Ism is an antiphilosophy, a way of being without thinking. The masters of ism 
are rocks, trees, clams; but it is the fate of higher animal species to have to strive for ism, 
without ever being able to attain it fully. Still, one is occasionally granted glimpses of 
ism. Perhaps the following koan offers such a glimpse 7 

Hyakujo wished to send a monk to open a new monastery. He told his pupils that 
whoever answered a question most ably would be appointed. Placing a water vase on 
the ground, he asked: "Who can say what this is without calling its name?" 
The chief monk said: "No one can call it a wooden shoe." 

Isan, the cooking monk, tipped over the vase with his foot and went out. Hyakujo 
smiled and said: "The chief monk loses." And Isan became the 
master of the new monastery. 

To suppress perception, to suppress logical, verbal, dualistic thinking-this is the essence 
of Zen, the essence of ism. This is the Unmode-not Intelligent, not Mechanical, just "Un". 
Joshu was in the Unmode, and that is why his 'MU' unasks the question. The Un-mode 
came naturally to Zen Master Unmon: 8 

One day Unmon said to his disciples, "This staff of mine has transformed itself into a 
dragon and has swallowed up the universe! Oh, where are the rivers and mountains 
and the great earth?" 

Zen is holism, carried to its logical extreme. If holism claims that things can only be 
understood as wholes, not as sums of their parts, Zen goes one further, in maintaining that 
the world cannot be broken into parts at all. To divide the world into parts is to be 
deluded, and to miss enlightenment. 

A master was asked the question, "What is the Way?" by a curious monk. " 
It is right before your eyes," said the master. "Why do I not see it for myself?" 
"Because you are thinking of yourself." 
"What about you: do you see it?" 

"So long as you see double, saying T don't', and "you do', and so on, your 
eyes are clouded," said the master. 
"When there is neither T nor 'You', can one see it?" 
"When there is neither T nor "You', who is the one that wants to see it?" 9 

Mumon and Godel 


Apparently the master wants to get across the idea that an enlighte state is one 
where the borderlines between the self and the rest of universe are dissolved. This would 
truly be the end of dualism, for a says, there is no system left which has any desire for 
perception. But what is that state, if not death? How can a live human being dissolve the 
borderlines between himself and the outside world? 

Zen and Tumbolia 

The Zen monk Bassui wrote a letter to one of his disciples who was about to die, and in it 
he said: "Your end which is endless is as a snowflake dissolving in the pure air." The 
snowflake, which was once very much a discernible subsystem of the universe, now 
dissolves into the larger system which 4 held it. Though it is no longer present as a 
distinct subsystem, its essence somehow still present, and will remain so. It floats in 
Tumbolia, along hiccups that are not being hiccupped and characters in stories that are 
being read . . . That is how I understand Bassui's message. 

Zen recognizes its own limitations, just as mathematicians have lea: to recognize 
the limitations of the axiomatic method as a method attaining truth. This does not mean 
that Zen has an answer to what beyond Zen any more than mathematicians have a clear 
understanding the forms of valid reasoning which lie outside of formalization. One ol 
clearest Zen statements about the borderlines of Zen is given in the fol ing strange koan, 
very much in the spirit of Nansen: 10 

Tozan said to his monks, "You monks should know there is an even high 
understanding in Buddhism." A monk stepped forward and asked, "What the higher 
Buddhism?" Tozan answered, "It is not Buddha." 

There is always further to go; enlightenment is not the end-all of And there is no recipe 
which tells how to transcend Zen; the only thing can rely on for sure is that Buddha is not 
the way. Zen is a system cannot be its own metasystem; there is always something 
outside of which cannot be fully understood or described within Zen. 

Escher and Zen 

In questioning perception and posing absurd answerless riddles, Zen company, in the 
person of M. C. Escher. Consider Day and Night (Fig. 4 masterpiece of "positive and 
negative interwoven" (in the words of Mumoni). One might ask, "Are those really birds, 
or are they really field it really night, or day?" Yet we all know there is no point to such 
questions The picture, like a Zen koan, is trying to break the mind of logic. Es4 also 
delights in setting up contradictory pictures, such as Another World 

Mumon and Godel 


FIGURE 51. Puddle, by M. C. Escher (woodcut, 1952). 

(Fig. 48)-pictures that play with reality and unreality the same way as Zen plays with 
reality and unreality. Should one take Escher seriously? Should one take Zen seriously? 

There is a delicate, haiku-like study of reflections in Dewdrop (Fig. 47); and then 
there are two tranquil images of the moon reflected in still waters: Puddle (Fig. 51), and 
Rippled Surface (Fig. 52). The reflected moon is a theme which recurs in various koans. 
Here is an example:' 

Chiyono studied Zen for many years under Bukko of Engaku. Still, she could not 
attain the fruits of meditation. At last one moonlit night she was carrying water in an 
old wooden pail girded with bamboo. The bamboo broke, and the bottom fell out of 
the pail. At that moment, she was set free. Chiyono said, "No more water in the pail, 
no more moon in the water." 

Three Worlds: an Escher picture (Fig. 46), and the subject of a Zen koan:12 

A monk asked Ganto, "When the three worlds threaten me, what shall I do?" Ganto 
answered, "Sit down." "I do not understand," said the monk. Canto said, "Pick up the 
mountain and bring it to me. Then I will tell you." 

Mumon and Godel 


Hemiolia and Escher 

In Verbum (Fig. 149), oppositions are made into unities on several I Going around we see 
gradual transitions from black birds to white birds to black fish to white fish to black 
frogs to white frogs to black birds ... six steps, back where we started! Is this a 
reconciliation of the dichotomy of black and white? Or of the trichotomy of birds, fish, 
and frogs? Or sixfold unity made from the opposition of the evenness of 2 an oddness of 
3? In music, six notes of equal time value create a rhythmic ambiguity-are they 2 groups 
of 3, or 3 groups of 2? This ambiguity has a name: hemiolia. Chopin was a master of 
hemiolia: see his Waltz op. his Etude op. 25, no. 2. In Bach, there is the Tempo di 
Menuetto from the keyboard Partita no. 5, or the incredible Finale of the first Sonata 
unaccompanied violin, in G Minor. 

As one glides inward toward the center of Verbum, the distinctions gradually blur, 
so that in the end there remains not three, not two, but one single essence: "VERBUM", 
which glows with brilliancy-perhaps a symbol of enlightenment. Ironically, " verbum" 
not only is a word, but "word" -not exactly the most compatible notion with Zen. On the 
hand, "verbum" is the only word in the picture. And Zen master 1 once said, "The 
complete Tripitaka can be expressed in one character ("Tripitaka", meaning "three 
baskets", refers to the complete texts c original Buddhist writings.) What kind of 
decoding-mechanism, I wonder would it take to suck the three baskets out of one 
character? Perhaps one with two hemispheres. 

FIGURE 52. Rippled Surface, by M. C. Escher (lino-cut, 1950). 

Mumon and Godel 


FIGURE 53. Three Spheres II, by M. C. Escher (lithograph, 1946), 

Indra's Net 

Finally, consider Three Spheres II (Fig. 53), in which every part of the world seems to 
contain, and be contained in, every other part: the writing table reflects the spheres on top 
of it, the spheres reflect each other, as well as the writing table, the drawing of them, and 
the artist drawing it. The endless connections which all things have to each other is only 
hinted at here, yet the hint is enough. The Buddhist allegory of "Indra's Net" tells of an 
endless net of threads throughout the universe, the horizontal threads running through 
space, the vertical ones through time. At every crossing of threads is an individual, and 
every individual is a crystal bead. The great light of "Absolute Being" illuminates and 
penetrates every crystal bead; moreover, every crystal bead reflects not only the light 
from every other crystal in the net-but also every reflection of every reflection throughout 
the universe. 

To my mind, this brings forth an image of renormalized particles: in every 
electron, there are virtual photons, positrons, neutrinos, muons ... ; in every photon, there 
are virtual electrons, protons, neutrons, pions ... ; in every pion, there are ... 

But then another image rises: that of people, each one reflected in the minds of 
many others, who in turn are mirrored in yet others, and so on. 

Both of these images could be represented in a concise, elegant way by using 
Augmented Transition Networks. In the case of particles, there would be one network for 
each category of particle; in the case of people, 

Mumon and Godel 


one for each person. Each one would contain calls to many others, t creating a virtual 
cloud of ATN's around each ATN. Calling one we create calls on others, and this process 
might cascade arbitrarily far, un~ bottomed out. 

Mumon on MU 

Let us conclude this brief excursion into Zen by returning to Mumon. H is his comment 
onJoshu'sMU 13 

To realize Zen one has to pass through the barrier of the patriarchs. Enlightenment 
always comes after the road of thinking is blocked. If you do nc pass the barrier of the 
patriarchs or if your thinking road is not blocked whatever you think, whatever you 
do, is like a tangling ghost. You may ask "What is a barrier of a patriarch?" This one 
word, 'MU', is it. 

This is the barrier of Zen. If you pass through it, you will see Joshu face t face. 
Then you can work hand in hand with the whole line of patriarchs. I this not a pleasant 
thing to do? 

If you want to pass this barrier, you must work through every bone in you body, 
through every pore of your skin, filled with this question: "What 'MU'?" and carry it 
day and night. Do not believe it is the common negative symbol meaning nothing. It is 
not nothingness, the opposite of existence. I you really want to pass this barrier, you 
should feel like drinking a hot iro ball that you can neither swallow nor spit out. 

Then your previous lesser knowledge disappears. As a fruit ripening i season, 
your subjectivity and objectivity naturally become one. It is like dumb man who has 
had a dream. He knows about it but he cannot tell i 

When he enters this condition his ego-shell is crushed and he can shake th heaven 
and move the earth. He is like a great warrior with a sharp sword. If Buddha stands in 
his way, he will cut him down; if a patriarch offers him an obstacle, he will kill him; 
and he will be free in his way of birth and death. H can enter any world as if it were 
his own playground. I will tell you how to d this with this koan: 

Just concentrate your whole energy into this MU, and do not allow an 
discontinuation. When you enter this MU and there is no discontinuation -- your 
attainment will be as a candle burning and illuminating the who] universe. 

From Mumon to the MU-puzzle 

From the ethereal heights of Joshu's MU, we now descend to the private lowlinesses of 
Hofstadter's MU ... I know that you have already concentrated your whole energy into 
this MU (when you read Chapter 1). So n wish to answer the question which was posed 

Has MU theorem-nature, or not? 

The answer to this question is not an evasive MU; rather, it is a resounding NO. In order 
to show this, we will take advantage of dualistic, logical thinking. 

Mumon and Godel 


We made two crucial observations in Chapter I: 

(1) that the MU-puzzle has depth largely because it involves the interplay of 
lengthening and shortening rules; 

(2) that hope nevertheless exists for cracking the problem by employing a tool which 

is in some sense of adequate depth to handle matters of that complexity: the 
theory of numbers. 

We did not analyze the MU-puzzle in those terms very carefully in Chapter I; we shall do 
so now. And we will see how the second observation (when generalized beyond the 
insignificant MlU-system) is one of the most fruitful realizations of all mathematics, and 
how it changed mathematicians' view of their own discipline. 

For your ease of reference, here is a recapitulation of the MlU-system: 


Axiom: MI 


I. If xl is a theorem, so is xIU. 

II. If Mx is a theorem, so is Mxx. 

III. In any theorem, III can be replaced by U. 

IV. UU can be dropped from any theorem. 

Mumon Shows Us How to Solve the MU-puzzle 

According to the observations above, then, the MU-puzzle is merely a puzzle about 
natural numbers in typographical disguise. If we could only find a way to transfer it to the 
domain of number theory, we might be able to solve it. Let us ponder the words of 
Mumon, who said, "If any of you has one eye, he will see the failure on the teacher's 
part." But why should it matter to have one eye? 

If you try counting the number of l's contained in theorems, you will soon notice 
that it seems never to be 0. In other words, it seems that no matter how much lengthening 
and shortening is involved, we can never work in such a way that all l's are eliminated. 
Let us call the number of l's in any string the I-count of that string. Note that the I-count 
of the axiom MI is 1 . We can do more than show that the I-count can't be 0-we can show 
that the I-count can never be any multiple of 3. 

To begin with, notice that rules I and IV leave the I-count totally undisturbed. 
Therefore we need only think about rules II and III. As far as rule III is concerned, it 
diminishes the I-count by exactly 3. After an application of this rule, the I-count of the 
output might conceivably be a multiple of 3-but only if the I-count of the input was also. 
Rule III, in short, never creates a multiple of 3 from scratch. It can only create one when 
it began with one. The same holds for rule II, which doubles the 

Mumon and Godel 


I-count. The reason is that if 3 divides 2n, then-because 3 does not dig 2-it must divide n 
(a simple fact from the theory of numbers). Neither rule II nor rule III can create a 
multiple of 3 from scratch. 

But this is the key to the MU-puzzle! Here is what we know: 

(1) The I-count begins at 1 (not a multiple of 3); 

(2) Two of the rules do not affect the I-count at all; (3) 

(3) The two remaining rules which do affect the I-count do so in such a way as never 
to create a multiple of 3 unless given one initially. 

The conclusion-and a typically hereditary one it is, too-is that I-count can never become 
any multiple of 3. In particular, 0 is a forbid value of the I-count. Hence, MU is not a 

theorem of the MlU-system. 
Notice that, even as a puzzle about I-counts, this problem was plagued by the 
crossfire of lengthening and shortening rules. Zero became the goal; I-counts could 
increase (rule II), could decrease (rule III). 1 we analyzed the situation, we might have 
thought that, with enough switching back and forth between the rules, we might 
eventually hit 0. IS thanks to a simple number-theoretical argument, we know that the 

Godel-Numbering the MlU-System 

Not all problems of the the type which the MU-puzzle symbolizes at easy to solve as this 
one. But we have seen that at least one such pr could be embedded within, and solved 
within, number theory. We are going to see that there is a way to embed all problems 
about any for system, in number theory. This can happen thanks to the discovery Godel, 
of a special kind of isomorphism. To illustrate it, I will use MlU-system. 

We begin by considering the notation of the MlU-system. We map each symbol onto a 
new symbol: 

M <==>3 
I <==> 1 
U<==> 0 

The correspondence was chosen arbitrarily; the only rhyme or reason is that each symbol 
looks a little like the one it is mapped onto. I number is called the Godel number of the 
corresponding letter. Now I sure you can guess what the Godel number of a multiletter 
string will be: 

MU <==>30 
MIIU <= => 3110 

Mumon and Godel 


It is easy. Clearly this mapping between notations is an information preserving 
transformation; it is like playing the same melody on two different instruments. 

Let us now take a look at a typical derivation in the MlU-system, written 
simultaneously in both notations: 

The left-hand column is obtained by applying our four familiar typographical rules. The 
right-hand column, too, could be thought of as having been generated by a similar set of 
typographical rules. Yet the right-hand column has a dual nature. Let me explain what 
this means. 

Seeing Things Both Typographically and Arithmetically 

We could say of the fifth string ('3010') that it was made from the fourth, by appending a 
'0' on the right; on the other hand we could equally well view the transition as caused by 
an arithmetical operation-multiplication by 10, to be exact. When natural numbers are 
written in the decimal system, multiplication by 10 and putting a '0' on the right are 
indistinguishable operations. We can take advantage of this to write an arithmetical rule 
which corresponds to typographical rule I: 

ARITHMETICAL RULE la: A number whose decimal expansion ends on the right in x 1' 
can be multiplied by 10. 

We can eliminate the reference to the symbols in the decimal expansion by arithmetically 
describing the rightmost digit: 

ARITHMETICAL RULE lb: A number whose remainder when divided by 10 is 1, can 
be multiplied by 10. 

Now we could have stuck with a purely typographical rule, such as the following one: 

TYPOGRAPHICAL RULE I: From any theorem whose rightmost symbol is ' 1' a new 
theorem can be made, by appending "0' to the right of that 1'. 

They would have the same effect. This is why the right-hand column has a "dual nature": 
it can be viewed either as a series of typographical opera- 

Mumon and Godel 270 








axiom 31 

rule 2 311 

rule 2 31111 

rule 3 301 

rulel 3010 

rule 2 3010010 

rule 4 30110 

tions changing one pattern of symbols into another, or as a series arithmetical operations 
changing one magnitude into another. But the are powerful reasons for being more 
interested in the arithmetical version Stepping out of one purely typographical system 
into another isomorphic typographical system is not a very exciting thing to do; whereas 
stepping clear out of the typographical domain into an isomorphic part of number theory 
has some kind of unexplored potential. It is as if somebody h known musical scores all 
his life, but purely visually-and then, all o: sudden, someone introduced him to the 
mapping between sounds a musical scores. What a rich, new world! Then again, it is as if 
somebody h been familiar with string figures all his life, but purely as string figur devoid 
of meaning-and then, all of a sudden, someone introduced him the mapping between 
stories and strings. What a revelation! The discovery of Godel-numbering has been 
likened to the discovery, by Descartes, of t isomorphism between curves in a plane and 
equations in two variables; incredibly simple, once you see it-and opening onto a vast 
new world 

Before we jump to conclusions, though, perhaps you would like to a more 
complete rendering of this higher level of the isomorphism. It i very good exercise. The 
idea is to give an arithmetical rule whose action is indistinguishable from that of each 
typographical rule of the MlU-system: 

A solution is given below. In the rules, m and k are arbitrary natural numbers, and n is 
any natural number which is less than 10 m 

RULE 1: If we have made 10m + 1, then we can make 10 x (10m + 1) 
Example: Going from line 4 to line 5. Here, m = 30. 

RULE 2: If we have made 3 x 10" + n, then we can make 10' X X (3 x 10"'+n)+n. 
Example: Going from line 1 to line 2, where both m and n equal 1 . 

RULE 3: If we have made k x 10 M, + 1 1 1 x lO'+n, then we can make k x 10"+' + n. 
Example: Going from line 3 to line 4. Here, m and n are 1, and k is 3. 

RULE 4: If we have made k x lOrn+z + n, k x 10" +n. then we can make k x 10m + n 
Example: Going from line 6 to line 7. Here, m = 2, n = 10, and k = 301. 

Let us not forget our axiom! Without it we can go nowhere. Therefore, let us postulate 

We can make 3 1 . 

Now the right-hand column can be seen as a full-fledged arithmetic process, in a new 
arithmetical system which we might call the 310-system 

Mumon and Godel 













rule 2 (m=l, n=l) 
rule 2 (m=2, n=ll) 
rule 3 (m=l, n=l, k=3) 
rule 1 (m=30) 
rule 2 (m=3, n=10) 

Notice once again that the lengthening and shortening rules are ever with us in this "310- 
system"; they have merely been transposed into the domain of numbers, so that the Godel 
numbers go up and down. If you look carefully at what is going on, you will discover that 
the rules are based on nothing more profound than the idea that shifting digits to left and 
right in decimal representations of integers is related to multiplications and divisions by 
powers of 10. This simple observation finds its generalization in the following 

CENTRAL PROPOSITION: If there is a typographical rule which tells how 
certain digits are to be shifted, changed, dropped, or inserted in any number 
represented decimally, then this rule can be represented equally well by an 
arithmetical counterpart which involves arithmetical operations with powers of 10 
as well as additions, subtractions, and so forth. 

Typographical rules for manipulating numerals are actually arithmetical rules for 
operating on numbers. 

This simple observation is at the heart of Godel 's method, and it will have an absolutely 
shattering effect. It tells us that once we have a Godel numbering for any formal system, 
we can straightaway form a set of arithmetical rules which complete the Godel 
isomorphism. The upshot is that we can transfer the study of any formal system-in fact 
the study of all formal systems-into number theory. 

Just as any set of typographical rules generates a set of theorems, a corresponding set of 
natural numbers will be generated by repeated applications of arithmetical rules. These 
producible numbers play the same role inside number theory as theorems do inside any 
formal system. Of course, different numbers will be producible, depending on which 
rules are adopted. "Producible numbers" are only producible relative to a system of 
arithmetical rules. For example, such numbers as 31, 3010010, 3111, and so forth could 
be called Mil] -producible numbers-an ungainly name, which might be shortened to 
MlV-numbers, symbolizing the fact that those numbers are the ones that result when you 
transcribe the MlU-system into number theory, via Godel-numbering. If we were to 
Godel-number the pq-system 

Mumon and Godel 272 

More briefly: 

MIU-Producible Numbers 

and then "arithmetize" its rules, we could call the producible numbers "pq-numbers"-and 
so on. 

Note that the producible numbers (in any given system) are defined by a recursive 
method: given numbers which are known to be producible, we have rules telling how to 
make more producible numbers. Thus, the class of numbers known to be producible is 
constantly extending itself, in much the same way that the list of Fibonacci numbers, or 
Q-numbers, does. The set of producible numbers of any system is a recursively 
enumerable set. What about its complement-the set of nonproducible numbers? Is that set 
always recursively enumerable? Do numbers which are nonproducible share some 
common arithmetical feature? 

This is the sort of issue which arises when you transpose the study of formal 
systems into number theory. For each system which is arithmetized, one can ask, "Can 
we characterize producible numbers in a simple way?" "Can we characterize 
nonproducible numbers in a recursively enumerable way?" These are difficult questions 
of number theory. Depending on the system which has been arithmetized, such questions 
might prove too hard for us to resolve. But if there is any hope for solving such problems, 
it would have to reside in the usual kind of step-by-step reasoning as it applies to natural 
numbers. And that, of course, was put in its quintessential form in the previous Chapter. 
TNT seemed, to all appearances, to have captured all valid mathematical thinking 
processes in one single, compact system. 

Answering Questions about Producible Numbers 
by Consulting TNT 

Could it be, therefore, that the means with which to answer any question about any 
formal system lies within just a single formal system-TNT? It seems plausible. Take, for 
instance, this question: 

Is MU a theorem of the MlU-system? 

Finding the answer is equivalent to determining whether 30 is a MIU number or not. 
Because it is a statement of number theory, we should expect that, with some hard work, 
we could figure out how to translate the sentence "30 is a MlU-number" into TNT- 
notation, in somewhat the same way as we figured out how to translate other number- 
theoretical sentences into TNT-notation. I should immediately caution the reader that 
such a translation, though it does exist, is immensely complex. If you recall, I pointed out 
in Chapter VIII that even such a simple arithmetical predicate as "b is a power of 10" is 
very tricky to code into TNT-notation-and the predicate "b is a MlU-number" is a lot 
more complicated than that! Still, it can be found; and the numeral 
SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSO can be substituted for every b. This will 
result in a MONstrous string of TNT, a string of TNT which speaks about the MU- 
puzzle. Let us therefore call that string "MUMON". Through MUMON and strings like 
it, TNT is now capable of speaking "in code" about the MlU-system. 

Mumon and Godel 


The Dual Nature of MUMON 

In order to gain some benefit from this peculiar transformation of the original question, 
we would have to seek the answer to a new question: 

Is MUMON a theorem of TNT? 

All we have done is replace one relatively short string (MU) by another (the monstrous 
MUMON), and a simple formal system (the MlU-system) by a complicated one (TNT). 
It isn't likely that the answer will be any more forthcoming even though the question has 
been reshaped. In fact, TNT has a full complement of both lengthening and shortening 
rules, and the reformulation of the question is likely to be far harder than the original. 
One might even say that looking at MU via MUMON is an intentionally idiotic way of 
doing things. However, MUMON can be looked at on more than one level. 

In fact, this is an intriguing point: MUMON has two different passive meanings. 
Firstly, it has the one which was given before: 

30 is a MlU-number. 

But secondly, we know that this statement is tied (via isomorphism) to the statement 

MU is a theorem of the MlU-system. 

So we can legitimately quote this latter as the second passive meaning of MUMON. It 
may seem very strange because, after all, MUMON contains nothing but plus signs, 
parentheses, and so forth-symbols of TNT. How can it possibly express any statement 
with other than arithmetical content? 

The fact is, it can. Just as a single musical line may serve as both harmony and 
melody in a single piece; just as "BACH" may be interpreted as both a name and a 
melody; just as a single sentence may be an accurate structural description of a picture by 
Escher, of a section of DNA, of a piece by Bach, and of the dialogue in which the 
sentence is embedded, so MUMON can be taken in (at least) two entirely different ways. 
This state of affairs comes about because of two facts: 

Fact 1 . Statements such as "MU is a theorem" can be coded into number theory 
via Godel's isomorphism. 

Fact 2. Statements of number theory can be translated into TNT. 

It could be said that MUMON is, by Fact 1, a coded message, where the symbols of the 
code are, by Fact 2, just symbols of TNT. 

Mumon and Godel 


Codes and Implicit Meaning 

Now it could be objected here that a coded message, unlike an uncod message, does not 
express anything on its own-it requires knowledge the code. But in reality there is no 
such thing as an uncoded message. There are only messages written in more familiar 
codes, and message written in less familiar codes. If the meaning of a message is to be 
revealed it must be pulled out of the code by some sort of mechanism, or isomorphism. It 
may be difficult to discover the method by which the decoding should be done; but once 
that method has been discovered, the message becomes transparent as water. When a 
code is familiar enough, it ceases appearing like a code; one forgets that there is a 
decoding mechanism. The message is identified with its meaning. 

Here we have a case where the identification of message and meant is so strong 
that it is hard for us to conceive of an alternate meaning: residing in the same symbols. 
Namely, we are so prejudiced by the symbols of TNT towards seeing number-theoretical 
meaning (and only numb( theoretical meaning) in strings of TNT, that to conceive of 
certain string of TNT as statements about the MlU-system is quite difficult. But Godel's 
isomorphism compels us to recognize this second level of meaning certain strings of 

Decoded in the more familiar way, MUMON bears the message: 

30 is a MlU-number. 

This is a statement of number theory, gotten by interpreting each sign the conventional 

But in discovering Godel-numbering and the whole isomorphism bu upon it, we 
have in a sense broken a code in which messages about the MlU-system are written in 
strings of TNT. Godel's isomorphism is a n( information-revealer, just as the 
decipherments of ancient scripts we information-revealers. Decoded by this new and less 
familiar mechanism MUMON bears the message 

MU is a theorem of the MlU-system. 

The moral of the story is one we have heard before: that meaning is ; automatic by- 
product of our recognition of any isomorphism; therefore there are at least two passive 
meanings of MUMON-maybe more! 

The Boomerang: Godel-Numbering TNT 

Of course things do not stop here. We have only begun realizing the: potential of Godel's 
isomorphism. The natural trick would be to turn TNT's capability of mirroring other 
formal systems back on itself, as the Tortoise turned the Crab's phonographs against 
themselves, and as his Goblet G turned against itself, in destroying itself. In order to do 
this, we 

Mumon and Godel 


will have to Godel-number TNT itself, just as we did the MlU-system, and then 
"arithmetize" its rules of inference. The Godel-numbering is easy to do. For instance, we 
could make the following correspondence: 



Mnemonic Justification 



Number of the Beast for the Mysterious 



successorship: 1, 2, 3, 



visual resemblance, turned sideways 


1 10 

1 12 

1 + 1— 2 

• • . . . 


o o f 



ends in 2 * 



enus in j 

Z 1Z 

ends in 2 * these three pairs 

~> .... 

Zl J 

ends in 3 * form a pattern 



eiius in z 


j — 


ends in 3 * 

VllVlkJ 1.1.1. 



opposite to V (626) 



163 is prime 



'a' is a "graph" of the sequence 1-6-1 



V is a "graph" of the sequence 6-1-6 



' 6 "implies" 3 and 3, in some sense . 


. 2 + 2 is not 3 



^3' looks like '3' 



opposite to a; also a "graph" of 6-2-6 


• • 


two dots, two sixes 



special number, as on Bell system (411, 

Each symbol of TNT is matched up with a triplet composed of the digits 1, 2, 3, 
and 6, in a manner chosen for mnemonic value. I shall call each such triplet of digits a 
Godel codon, or codon for short. Notice that I have given no codon for b, c, d, or e; we 
are using austere TNT. There is a hidden motivation for this, which you will find out 
about in Chapter XVI. I will explain the bottom entry, "punctuation", in Chapter XIV. 

Now we can rewrite any string or rule of TNT in the new garb. Here, for instance, 
is Axiom 1 in the two notations, the old below the new: 

626,262,636,223,123,262,1 1 1,666 
V- a : ~ S a = 0 

Conveniently, the standard convention of putting in a comma every third digit happens to 
coincide with our colons, setting them off for "easy" legibility. 

Here is the Rule of Detachment, in the new notation: 

RULE: If x and 212x6331213 are both theorems, then 1 is a theorem. Finally, here is an 
entire derivation taken from last Chapter, given in austere TNT and also transcribed into 
the new notation: 

Mumon and Godel 


626,262,636,626262,163,636,362262,112,123,262,163,323,111,123,362,262,112,262,163,323 axiom: 

-¥ a : : ¥ a ' : (oc + 5oc' ) = s ( cc + a ') 

626,262.163,636,362,123,666,112,123,262,163,323,111,123,362,123,666,112,262,163,32 specification 

-¥a':(so+soc') = s( so+a') 

362,123,666,112,123,666,323,1 11,123,362,123,666,112,666,323 specification 

( SO + 5 0 ) = S ( SO + 0 ) 
626,262,636,362 262,112,666, 3 23,111,262 axiom 

¥• a : ( a + o ) = a 

362,123,666,112,666,323,111,123,666 specification 

( S 0 + 0 ) = so 
123,362,123,666,112,666,323,11 1,123,123,666 insert '12; 

S (S0+0 ) = sso 
362,123,666,112,123,666,323,111,123,123,666 transitivity 

(SO + 50 ) = SSO 

Notice that I changed the name of the "Add S" rule to "Insert ' 123' ", since that is the 
typographical operation which it now legitimizes. 

This new notation has a pretty strange feel to it. You lose all sense o meaning; but 
if you had been brought up on it, you could read strings it this notation as easily as you do 
TNT. You would be able to look and, at glance, distinguish well-formed formulas from 
ill-formed ones. Naturally since it is so visual, you would think of this as a typographical 
operation but at the same time, picking out well-formed formulas in this notation i 
picking out a special class of integers, which have an arithmetical definition too. 

Now what about "arithmetizing" all the rules of inference? As matter stand, they 
are all still typographical rules. But wait! According to the Central Proposition, a 
typographical rule is really equivalent to al arithmetical rule. Inserting and moving digits 
in decimally represented numbers is an arithmetical operation, which can be carried out 
typographically. Just as appending a 'O' on the end is exactly the same as multiplying b, 
10, so each rule is a condensed way of describing a messy arithmetical operation. 
Therefore, in a sense, we do not even need to look for equivalent arithmetical rules, 
because all of the rules are already arithmetical! 

TNT-Numbers: A Recursively Enumerable Set of Numbers 

Looked at this way, the preceding derivation of the theorem 
"362,123,666,112,123,666,323,111,123,123,666" is a sequence of high] convoluted 
number-theoretical transformations, each of which acts on one or more input numbers, 
and yields an output number, which is, as before, called a producible number, or, to be 
more specific, a TNT-number. Some the arithmetical rules take an old TNT-number and 
increase it in a particular way, to yield a new TNT-number; some take an old TNT- 
number a and decrease it; other rules take two TNT-numbers, operate on each of them 
some odd way, and then combine the results into a new TNT-number 
and so on and so forth. And instead of starting with just one know: 'TNT-number, we 
have five initial TNT-numbers-one for each (austere axiom, of course. Arithmetized TNT 
is actually extremely similar to the 

Mumon and Godel 


arithmetized MlU-system, only there are more rules and axioms, and to write out 
arithmetical equivalents explicitly would be a big bother-and quite unenlightening, 
incidentally. If you followed how it was done for the MlU-system, there ought to be no 
doubt on your part that it is quite analogous here. 

There is a new number-theoretical predicate brought into being by this 
"Godelization" of TNT: the predicate 

a is a TNT-number. 

For example, we know from the preceding derivation that 
362,123,666,112,123,666,323,111,123,123,666 is a TNT-number, while on the other 
hand, presumably 123,666,1 1 1,666 is not a TNT-number. 

Now it occurs to us that this new number- theoretical! predicate is expressible by 
some string of TNT with one free variable, say a. We could put a tilde in front, and that 
string would express the complementary notion 

a is not a TNT-number. 

Now if we replaced all the occurrences of a in this second string by the TNT-numeral for 
123,666,1 1 1,666-a numeral which would contain exactly 123,666,111,666 S's, much too 
long to write out-we would have a TNT-string which, just like MUMON, is capable of 
being interpreted on two levels. In the first place, that string would say 

123,666,1 1 1,666 is not a TNT-number. 

But because of the isomorphism which links TNT-numbers to theorems of TNT, there 
would be a second-level meaning of this string, which is: 

S0=0 is not a theorem of TNT. 

TNT Tries to Swallow Itself 

This unexpected double-entendre demonstrates that TNT contains strings which talk 
about other strings of TNT. In other words, the metalanguage in which we, on the 
outside, can speak about TNT, is at least partially imitated inside TNT itself. And this is 
not an accidental feature of TNT; it happens because the architecture of any formal 
system can be mirrored inside N (number theory). It is just as inevitable a feature of TNT 
as are the vibrations induced in a record player when it plays a record. It seems as if 
vibrations should come from the outside world-for instance, from jumping children or 
bouncing balls; but a side effect of producing sounds-and an unavoidable one-is that they 
wrap around and shake the very mechanism which produces them. It is no accident; it is a 
side effect which cannot be helped. It is in the nature of record players. And it is in the 
nature of any formalization of number theory that its metalanguage is embedded within it. 

Mumon and Godel 


We can dignify this observation by calling it the Central Dogma of Mlathematical 
Logic, and depicting it in a two-step diagram: 

TNT =>N =>meta-'TNT 

In words: a string of TNT has an interpretation in N; and a statement o may have a 
second meaning as a statement about TNT. 

G: A String Which Talks about Itself in Code 

This much is intriguing yet it is only half the story. The rest of the st involves an 
intensification of the self-reference. We are now at the st where the Tortoise was when he 
realized that a record could be m; which would make the phonograph playing it break-but 
now the quest is: "Given a record player, how do you actually figure out what to put the 
record?" That is a tricky matter. 

We want to find a string of TNT-which we'll call 'G'-which is ab itself, in the 
sense that one of its passive meanings is a sentence about G. particular the passive 
meaning will turn out to be 

"G is not a theorem of TNT." 

I should quickly add that G also has a passive meaning which is a statement of number 
theory; just like MUMON it is susceptible to being construed in least) two different 
ways. The important thing is that each passive mean is valid and useful and doesn't cast 
doubt on the other passive meaning in any way. (The fact that a phonograph playing a 
record can induce vibrations in itself and in the record does not diminish in any way the 
fact t those vibrations are musical sounds!) 

G's Existence Is What Causes TNT's Incompleteness 

The ingenious method of creating G, and some important concepts relating to TNT, will 
be developed in Chapters XIII and XIV; for now it is interesting to glance ahead, a bit 
superficially, at the consequences finding a self-referential piece of TNT. Who knows? It 
might blow up! In a sense it does. We focus down on the obvious question: 

Is G a theorem of TNT, or not? 

Let us be sure to form our own opinion on this matter, rather than rely G's opinion about 
itself. After all, G may not understand itself any be than a Zen master understands 
himself. Like MUMON, G may express a falsity. Like MU, G may be a nontheorem. We 
don't need to believe every possible string of TNT-only its theorems. Now let us use our 
power of reasoning to clarify the issue as best we can at this point. 

We will make our usual assumption: that TNT incorporates valid 

Mumon and Godel 


methods of reasoning, and therefore that TNT never has falsities for theorems. In other 
words, anything which is a theorem of TNT expresses a truth. So if G were a theorem, it 
would express a truth, namely: "G is not a theorem". The full force of its self-reference 
hits us. By being a theorem, G would have to be a falsity. Relying on our assumption that 
TNT never has falsities for theorems, we'd be forced to conclude that G is not a theorem. 
This is all right; it leaves us, however, with a lesser problem. Knowing that G is not a 
theorem, we'd have to concede that G expresses a truth. Here is a situation in which TNT 
doesn't live up to our expectations-we have found a string which expresses a true 
statement yet the string is not a theorem. And in our amazement, we shouldn't lose track 
of the fact that G has an arithmetical interpretation, too-which allows us to summarize 
our findings this way: 

A string of TNT has been found; it expresses, unambiguously, a statement about 
certain arithmetical properties of natural numbers; moreover, by reasoning outside 
the system we can determine not only that the statement is a true one, but also that 
the string fails to be a theorem of TNT. And thus, if we ask TNT whether the 
statement is true, TNT says neither yes nor no. 

Is the Tortoise's string in the Mu Offering the analogue of G? Not quite. The 
analogue of the Tortoise's string is ~G. Why is this so? Well, let us think a moment about 
what -G says. It must say the opposite of what G says. G says, "G is not a theorem of 
TNT", so ~G must say "G is a theorem". We could rephrase both G and ~G this way: 

G: "I am not a theorem (of TNT)." 

~G: "My negation is a theorem (of TNT)." 

It is ~G which is parallel to the Tortoise's string, for that string spoke not about itself, but 
about the string which the Tortoise first proffered to Achilles — which had an extra knot 
on it (or one too few, however you want to look at it). 

Mumon Has the Last Word 

Mumon penetrated into the Mystery of the Undecidable anyone, in his concise poem on 
Joshu's MU: 

Has a dog Buddha-nature? 

This is the most serious question of all. 

If you say yes or no, 

You lose your own Buddha-nature. 

Mumon and Godel 


Prelude . . 

Achilles and the Tortoise have come to the residence of their friend the Crab, to 
make the acquaintance of one of his friends, the Anteater. The introductions 
having been made, the four of them settle down to tea. 

Tortoise We have brought along a little something for you, Mr. Crab. Crab: That's most 

kind of you. But you shouldn't have. 
Tortoise: Just a token of our esteem. Achilles, would you like to give it to Mr. C? 
Achilles: Surely. Best wishes, Mr. Crab. I hope you enjoy it. 

(Achilles hands the Crab an elegantly wrapped present, square and very thin. The 
Crab begins unwrapping it.) 

Anteater: I wonder what it could be. 

Crab: We'll soon find out. (Completes the unwrapping, and pulls out the gift Two 
records! How exciting! But there's no label. Uh-oh-is this another of your "specials", 
Mr. T? 

Tortoise: If you mean a phonograph-breaker, not this time. But it is in fact a custom- 
recorded item, the only one of its kind in the entire world. In fact, it's never even been 
heard before-except, of course, when Bach played it. 

Crab: When Bach played it? What do you mean, exactly? 

Achilles: Oh, you are going to be fabulously excited, Mr. Crab, when Mr. T tells you 

what these records in fact are. 
Tortoise: Oh, you go ahead and tell him, Achilles. 

Achilles: May I? Oh, boy! I'd better consult my notes, then. (Pulls out a small filing card, 
and clears his voice.) Ahem. Would you be interested in hearing about the remarkable 
new result in mathematics, to which your records owe their existence? 

Crab: My records derive from some piece of mathematics? How curious Well, now that 
you've provoked my interest, I must hear about it. 

Achilles: Very well, then. (Pauses for a moment to sip his tea, then resumes) Have you 
heard of Fermat's infamous "Last Theorem"? 

Anteater: I'm not sure ... It sounds strangely familiar, and yet I can't qui place it. 

Achilles: It's a very simple idea. Pierre de Fermat, a lawyer by vocation b mathematician 
by avocation, had been reading in his copy of the class text Arithmetica by 
Diophantus, and came across a page containing the equation 

a 2 +b 2 =c 2 



FIGURE 54. Mobius Strip II, by M. C. Escher (woodcut, 1963). 



He immediately realized that this equation has infinitely many solutions a, b, c, and then 
wrote in the margin the following notorious comment: 
The equation 

a 11 +b n =c n 

has solutions in positive integers a, b, c, and n only when n = 2 (an then there are 
infinitely many triplets a, b, c which satisfy the equation); but there are no 
solutions for n > 2. I have discovered a truly marvelous proof of this statement, 
which, unfortunately, this margin is too small to contain. 

Ever since that day, some three hundred years ago, mathematicians have been vainly 
trying to do one of two things: either to I Fermat's claim, and thereby vindicate 
Fermat's reputation, whit though very high, has been somewhat tarnished by skeptics 
who he never really found the proof he claimed to have found-or e: refute the claim, 
by finding a counterexample: a set of four integers a, b, c, and n, with n > 2, which 
satisfy the equation. Until recently, every attempt in either direction had met with 
failure. 1 sure, the Theorem has been proven for many specific values of i particular, 
all n up to 125,000. 

Anteater: Shouldn't it be called a "Conjecture" rather than a "Theorem it's never been 

given a proper proof? 
Achilles: Strictly speaking, you're right, but tradition has kept it this i 
Crab: Has someone at last managed to resolve this celebrated quest Achilles: Indeed! In 
fact, Mr. Tortoise has done so, and as usual, by a wizardly stroke. He has not only 
found a PROOF of Fermat's Theorem (thus justifying its name as well as vindicating 
Fermat; also a COUNTEREXAMPLE, thus showing that the skeptics had good 

Crab: Oh my gracious! That is a revolutionary discovery. 

Anteater: But please don't leave us in suspense. What magical integer they, that satisfy 
Fermat's equation? I'm especially curious about the value of n. 

Achilles: Oh, horrors! I'm most embarrassed! Can you believe this? the values at home on 
a truly colossal piece of paper. Unfortunately was too huge to bring along. I wish I 
had them here to show to y( it's of any help to you, I do remember one thing-the value 
of n only positive integer which does not occur anywhere in the continued fraction for 


Crab: Oh, what a shame that you don't have them here. But there reason to doubt what 
you have told us. 



FIGURE 55. Pierre de Fermat. 

Anteater: Anyway, who needs to see n written out decimally? Achilles has just told us 
how to find it. Well, Mr. T, please accept my hearty felicitations, on the occasion of 
your epoch-making discovery! 

Tortoise: Thank you. But what I feel is more important than the result itself is the 
practical use to which my result immediately led. 

Crab: I am dying to hear about it, since I always thought number theory was the Queen of 
Mathematics — the purest branch of mathematic — the one branch of mathematics 
which has No applications! 

Tortoise: You're not the only one with that belief, but in fact it is quite impossible to 
make a blanket statement about when or how some branch-or even some individual 
Theorem-of pure mathematics will have important repercussions outside of 
mathematics. It is quite unpredictable-and this case is a perfect example of that 

Achilles: Mr. Tortoise's double-barreled result has created a breakthrough in the field of 

acoustico-retrieval ! 
Anteater: What is acoustico-retrieval? 

Achilles: The name tells it all: it is the retrieval of acoustic information from extremely 
complex sources. A typical task of acoustico-retrieval is to reconstruct the sound 
which a rock made on plummeting into a lake from the ripples which spread out over 
the lake's surface. 

Crab: Why, that sounds next to impossible! 

Achilles: Not so. It is actually quite similar to what one's brain does, when it reconstructs 
the sound made in the vocal cords of another person from the vibrations transmitted 
by the eardrum to the fibers in the cochlea. 

Crab: I see. But I still don't see where number theory enters the picture, or what this all 
has to do with my new records. 



Achilles: Well, in the mathematics of acoustico-retrieval, there arise rr questions which 
have to do with the number of solutions of cer Diophantine equations. Now Mr. T has 
been for years trying to fit way of reconstructing the sounds of Bach playing his 
harpsichord, which took place over two hundred years ago, from calculations in% ing 
the motions of all the molecules in the atmosphere at the pre time. 

Anteater: Surely that is impossible! They are irretrievably gone, g forever! 

Achilles: Thus think the nave ... But Mr. T has devoted many year this problem, and 
came to the realization that the whole thing hinged on the number of solutions to the 

a n +b n =c n 

in positive integers, with n > 2. 
Tortoise: I could explain, of course, just how this equation arises, but I'm sure it would 
bore you. 

Achilles: It turned out that acoustico-retrieval theory predicts that Bach sounds can be 
retrieved from the motion of all the molecule the atmosphere, provided that EITHER 
there exists at least one solution to the equation 

Crab: Amazing! 

Anteater: Fantastic! 

Tortoise: Who would have thought! 

Achilles: I was about to say, "provided that there exists EITHER such a solution OR a 
proof that there are tic) solutions!" And therefore, Mr. T, in careful fashion, set about 
working at both ends of the problem, simultaneously. As it turns out, the discovery of 
the counterexample was the key ingredient to finding the proof, so the one led directly 
to the other. 

Crab: How could that be? 

Tortoise: Well, you see, I had shown that the structural layout of any pr of Fermat's Last 
Theorem-if one existed-could be described by elegant formula, which, it so happened, 
depended on the values ( solution to a certain equation. When I found this second 
equation my surprise it turned out to be the Fermat equation. An amusing accidental 
relationship between form and content. So when I found the counterexample, all I 
needed to do was to use those numbers blueprint for constructing my proof that there 
were no solutions to equation. Remarkably simple, when you think about it. I can't 
imagine why no one had ever found the result before. 

Achilles: As a result of this unanticipatedly rich mathematical success, Mr. T was able to 
carry out the acoustico-retrieval which he had long dreamed of. And Mr. Crab's 
present here represents a palpable realization of all this abstract work. 



Crab: Don't tell me it's a recording of Bach playing his own works for harpsichord! 

Achilles: I'm sorry, but I have to, for that is indeed just what it is! This is a set of two 
records of Johann Sebastian Bach playing all of his Well Tempered Clavier. Each 
record contains one of the two volumes of the Well-Tempered Clavier, that is to say, 
each record contains 24 preludes and fugues-one in each major and minor key. 

Crab: Well, we must absolutely put one of these priceless records on, immediately! And 
how can I ever thank the two of you? 

Tortoise: You have already thanked us plentifully, with this delicious tea which you have 

(The Crab slides one of the records out of its jacket, and puts it on. The sound of 
an incredibly masterful harpsichordist fills the room, in the highest imaginable 
fidelity. One even hears-or is it one's imagination? -the soft sounds of Bach singing 
to himself as he plays ...) 

Crab: Would any of you like to follow along in the score? I happen to have a unique 
edition of the Well-Tempered Clavier, specially illuminated by a teacher of mine who 
happens also to be an unusually fine calligrapher. Tortoise: I would very much enjoy 

(The Crab goes to his elegant glass-enclosed wooden bookcase, opens the doors, and 
draws out two large volumes.) 

Crab: Here you are, Mr. Tortoise. I've never really gotten to know all the beautiful 
illustrations in this edition. Perhaps your gift will provide the needed impetus for me 
to do so. 

Tortoise: I do hope so. 

Anteater: Have you ever noticed how in these pieces the prelude always sets the mood 
perfectly for the following fugue? 

Crab: Yes. Although it may be hard to put it into words, there is always some subtle 
relation between the two. Even if the prelude and fugue do not have a common 
melodic subject, there is nevertheless always some intangible abstract quality which 
underlies both of them, binding them together very strongly. 

Tortoise: And there is something very dramatic about the few moments of silent suspense 
hanging between prelude and fugue-that moment where the the theme of the fugue is 
about to ring out, in single tones, and then to join with itself in ever-increasingly 
complex levels of weird, exquisite harmony. 

Achilles: I know just what you mean. There are so many preludes and fugues which I 
haven't yet gotten to know, and for me that fleeting interlude of silence is very 
exciting; it's a time when I try to second-guess old Bach. For example, I always 
wonder what the fugue's tempo will be: allegro, or adagio? Will it be in 6/8, or 4/4? 
Will it have three voices, or five-or four? And then, the first voice starts ... Such an 
exquisite moment. 



Crab: Ah, yes, well do I remember those long-gone days of my youth, days when I 
thrilled to each new prelude and fugue, filled with excitement of their novelty and 
beauty and the many unexpected' surprises which they conceal. 

Achilles: And now? Is that thrill all gone? 

Crab: It's been supplanted by familiarity, as thrills always will be. But that familiarity 
there is also a kind of depth, which has its own compensations. For instance, I find 
that there are always new surprises whit hadn't noticed before. 

Achilles: Occurrences of the theme which you had overlooked? 

Crab: Perhaps-especially when it is inverted and hidden among several other voices, or 
where it seems to come rushing up from the dept out of nowhere. But there are also 
amazing modulations which ii marvelous to listen to over and over again, and wonder 
how old B2 dreamt them up. 

Achilles: I am very glad to hear that there is something to look forward after I have been 
through the first flush of infatuation with the Well Tempered C/avz'er-although it also 
makes me sad that this stage cot not last forever and ever. 

Crab: Oh, you needn't fear that your infatuation will totally die. One the nice things about 
that sort of youthful thrill is that it can always resuscitated, just when you thought it 
was finally dead. It just takes the right kind of triggering from the outside. 

Achilles: Oh, really? Such as what? 

Crab: Such as hearing it through the ears, so to speak, of someone whom it is a totally 

new experience-someone such as you, Achilles. Somehow the excitement transmits 

itself, and I can feel thrilled again. 
Achilles: That is intriguing. The thrill has remained dormant somewhere inside you, but 

by yourself, you aren't able to fish it up out of your subconscious. 
Crab: Exactly. The potential of reliving the thrill is "coded", in sot unknown way, in the 

structure of my brain, but I don't have the power to summon it up at will; I have to 

wait for chance circumstance trigger it. 
Achilles: I have a question about fugues which I feel a little embarrass about asking, but 

as I am just a novice at fugue-listening, I was wondering if perhaps one of you 

seasoned fugue-listeners might help me learning .. . 
Tortoise: I'd certainly like to offer my own meager knowledge, if it might prove of some 


Achilles: Oh, thank you. Let me come at the question from an angle. Are you familiar 

with the print called Cube with Magic Ribbons, by M. Escher? 
Tortoise: In which there are circular bands having bubble-like distortions which, as soon 

as you've decided that they are bumps, seem to turn it dents-and vice versa? 



FIGURE 56. Cube with Magic Ribbons, by M. C. Escher (lithograph, 1957). 

Achilles: Exactly. 

Crab: I remember that picture. Those little bubbles always seem to flip back and forth 
between being concave and convex, depending on the direction that you approach 
them from. There's no way to see them simultaneously as concave AND convex- 
somehow one's brain doesn't allow that. There are two mutually exclusive "modes" in 
which one can perceive the bubbles. 

Achilles: Just so. Well, I seem to have discovered two somewhat analogous modes in 
which I can listen to a fugue. The modes are these: either to follow one individual 
voice at a time, or to listen to the total effect of all of them together, without trying to 
disentangle one from another. I have tried out both of these modes, and, much to my 
frustration, each one of them shuts out the other. It's simply not in my power to follow 
the paths of individual voices and at the same time to hear the whole effect. I find that 
I flip back and forth between one mode and the other, more or less spontaneously and 



Anteater: Just as when you look at the magic bands, eh? 

Achilles: Yes. I was just wondering ... does my description of they modes of fugue- 
listening brand me unmistakably as a naive, inexperienced listener, who couldn't even 
begin to grasp the deeper mo, perception which exist beyond his ken? 

Tortoise: No, not at all, Achilles. I can only speak for myself, but I to myself shifting 
back and forth from one mode to the other without exerting any conscious control 
over which mode should he dominant don't know if our other companions here have 
also experience( thing similar. 

Crab: Most definitely. It's quite a tantalizing phenomenon, since you feel that the essence 
of the fugue is flitting about you, and you can't grasp all of it, because you can't quite 
make yourself function ways at once. 

Anteater: Fugues have that interesting property, that each of their voices is a piece of 
music in itself; and thus a fugue might be thought o collection of several distinct 
pieces of music, all based on one theme, and all played simultaneously. And it is up to 
the listener subconscious) to decide whether it should be perceived as a unit, c 
collection of independent parts, all of which harmonize. 

Achilles: You say that the parts are "independent", yet that can't be literally true. There 
has to be some coordination between them, otherwise when they were put together 
one would just have an unsystematic clashing of tones-and that is as far from the truth 
as could b, 

Anteater: A better way to state it might be this: if you listened to each on its own, you 
would find that it seemed to make sense all by its could stand alone, and that is the 
sense in which I meant that it is independent. But you are quite right in pointing out 
that each of individually meaningful lines fuses with the others in a highly nonrandom 
way, to make a graceful totality. The art of writing a beautiful fugue lies precisely in 
this ability, to manufacture several diff lines, each one of which gives the illusion of 
having been written I own beauty, and yet which when taken together form a whole, , 
does not feel forced in any way. Now, this dichotomy between he a fugue as a whole, 
and hearing its component voices, is a part: example of a very general dichotomy, 
which applies to many kit structures built up from lower levels. 

Achilles: Oh, really? You mean that my two "modes" may have some general type of 
applicability, in situations other than fugue-listening? 

Anteater: Absolutely. 

Achilles: I wonder how that could be. I guess it has to do with alternating between 
perceiving something as a whole, and perceiving it as a collection of parts. But the 
only place I have ever run into that dichotomy is in listening to fugues. 

Tortoise: Oh, my, look at this! I just turned the page while following the music, and came 
across this magnificent illustration facing the page of the fugue. 



Crab: I have never seen that illustration before. Why don't you pass it 'round? 

(The Tortoise passes the book around. Each of the foursome looks at it in a 
characteristic way-this one from afar, that one from close up, everyone tipping his 
head this way and that in puzzlement. Finally it has made the rounds, and returns 
to the Tortoise, who peers at it rather intently.) 

Achilles: Well, I guess the prelude is just about over. I wonder if, as I listen to this fugue, 
I will gain any more insight into the question, "What is the right way to listen to a 
fugue: as a whole, or as the sum of its parts?" 

TTortoise: Listen carefully, and you will! 

(The prelude ends. There is a moment of silence; and ... 





Levels of Description, 
and Computer Systems 

Levels of Description 

GODEL'S STRING G, and a Bach fugue: they both have the property that they can be 
understood on different levels. We are all familiar with this kind of thing; and yet in some 
cases it confuses us, while in others w handle it without any difficulty at all. For example, 
we all know that w human beings are composed of an enormous number of cells (around 
twenty-five trillion), and therefore that everything we do could in principle be described 
in terms of cells. Or it could even be described on the level c molecules. Most of us 
accept this in a rather matter-of-fact way; we go t the doctor, who looks at us on lower 
levels than we think of ourselves. W read about DNA and "genetic engineering" and sip 
our coffee. We seem t have reconciled these two inconceivably different pictures of 
ourselves simply by disconnecting them from each other. We have almost no way t relate 
a microscopic description of ourselves to that which we feel ourselves to be, and hence it 
is possible to store separate representations of ourselves in quite separate "compartments" 
of our minds. Seldom do we have to fir back and forth between these two concepts of 
ourselves, wondering "How can these two totally different things be the same me?" 

Or take a sequence of images on a television screen which show Shirley 
MacLaine laughing. When we watch that sequence, we know that we are actually looking 
not at a woman, but at sets of flickering dots on a flat surface. We know it, but it is the 
furthest thing from our mind. We have these two wildly opposing representations of what 
is on the screen, but that does not confuse us. We can just shut one out, and pay attention 
to th other-which is what all of us do. Which one is "more real"? It depends o; whether 
you're a human, a dog, a computer, or a television set. 

Chunking and Chess Skill 

One of the major problems of Artificial Intelligence research is to figure out how to 
bridge the gap between these two descriptions; how to construe a system which can 
accept one level of description, and produce the other One way in which this gap enters 
Artificial Intelligence is well illustrated b the progress in knowledge about how to 
program a computer to play goof chess. It used to be thought in the 1950's and on into the 

Levels of Description, and Computer Systems 


trick to making a machine play well was to make the machine look further ahead into the 
branching network of possible sequences of play than any chess master can. However, as 
this goal gradually became attained, the level of computer chess did not have any sudden 
spurt, and surpass human experts. In fact, a human expert can quite soundly and 
confidently trounce the best chess programs of this day. 

The reason for this had actually been in print for many years. In the 1940's, the 
Dutch psychologist Adriaan de Groot made studies of how chess novices and chess 
masters perceive a chess situation. Put in their starkest terms, his results imply that chess 
masters perceive the distribution of pieces in chunks. There is a higher-level description 
of the board than the straightforward "white pawn on K5, black rook on Q6" type of 
description, and the master somehow produces such a mental image of the board. This 
was proven by the high speed with which a master could reproduce an actual position 
taken from a game, compared with the novice's plodding reconstruction of the position, 
after both of them had had five-second glances at the board. Highly revealing was the fact 
that masters' mistakes involved placing whole groups of pieces in the wrong place, which 
left the game strategically almost the same, but to a novice's eyes, not at all the same. The 
clincher was to do the same experiment but with pieces randomly assigned to the squares 
on the board, instead of copied from actual games. The masters were found to be simply 
no better than the novices in reconstructing such random boards. 

The conclusion is that in normal chess play, certain types of situation recur- 
certain patterns-and it is to those high-level patterns that the master is sensitive. He thinks 
on a different level from the novice; his set of concepts is different. Nearly everyone is 
surprised to find out that in actual play, a master rarely looks ahead any further than a 
novice does-and moreover, a master usually examines only a handful of possible moves! 
The trick is that his mode of perceiving the board is like a filter: he literally does not see 
bad moves when he looks at a chess situation-no more than chess amateurs see illegal 
moves when they look at a chess situation. Anyone who has played even a little chess has 
organized his perception so that diagonal rook-moves, forward captures by pawns, and so 
forth, are never brought to mind. Similarly, master-level players have built up higher 
levels of organization in the way they see the board; consequently, to them, bad moves 
are as unlikely to come to mind as illegal moves are, to most people. This might be called 
implicit pruning of the giant branching tree of possibilities. By contrast, explicit pruning 
would involve thinking of a move, and after superficial examination, deciding not to 
pursue examining it any further. 

The distinction can apply just as well to other intellectual activities — for instance, 
doing mathematics. A gifted mathematician doesn't usually think up and try out all sorts 
of false pathways to the desired theorem, as less gifted people might do; rather, he just 
"smells" the promising paths, and takes them immediately. 

Computer chess programs which rely on looking ahead have not been taught to 
think on a higher level; the strategy has just been to use brute 

Levels of Description, and Computer Systems 


force look-ahead, hoping to crush all types of opposition. But it h worked. Perhaps 
someday, a look-ahead program with enough brute ,gill indeed overcome the best human 
players-but that will be a intellectual gain, compared to the revelation that intelligence de 
crucially on the ability to create high-level descriptions of complex such as chess boards, 
television screens, printed pages, or painting 

Similar Levels 

usually, we are not required to hold more than one level of understanding of a situation in 
our minds at once. Moreover, the different descriptions a single system are usually so 
conceptually distant from each other tl was mentioned earlier, there is no problem in 
maintaining them both are just maintained in separate mental compartments. What is 
confusing though, is when a single system admits of two or more descriptions different 
levels which nevertheless resemble each other in some way. we find it hard to avoid 
mixing levels when we think about the system can easily get totally lost. 

Undoubtedly this happens when we think about our psychology-for instance, 
when we try to understand people's motivations: for various actions. There are many 
levels in the human m structure-certainly it is a system which we do not understand very 
we But there are hundreds of rival theories which tell why people act the way they do, 
each theory based on some underlying assumptions about he down in this set of levels 
various kinds of psychological "forces" are f( Since at this time we use pretty much the 
same kind of language f mental levels, this makes for much level-mixing and most 
certain] hundreds of wrong theories. For instance, we talk of "drives"-for se power, for 
fame, for love, etc., etc. -without knowing where these drives come from in the human 
mental structure. Without belaboring the pc simply wish to say that our confusion about 
who we are is certainly r( to the fact that we consist of a large set of levels, and we use 
overlapping language to describe ourselves on all of those levels. 

Computer Systems 

There is another place where many levels of description coexist for a system, and where 
all the levels are conceptually quite close to one an( I am referring to computer systems. 
When a computer program is ping, it can be viewed on a number of levels. On each level, 
the description is given in the language of computer science, which makes all the de 
descriptions similar in some ways to each other-yet there are extremely imp( differences 
between the views one gets on the different levels. At the 1 level, the description can be 
so complicated that it is like the dot-description of a television picture. For some 
purposes, however, this is by far the important view. At the highest level, the description 
is greatly chunked and 

Levels of Description, and Computer Systems 


takes on a completely different feel, despite the fact that many of the same concepts 
appear on the lowest and highest levels. The chunks on the high-level description are like 
the chess expert's chunks, and like the chunked description of the image on the screen: 
they summarize in capsule form a number of things which on lower levels are seen as 
separate. (See Fig. 57.) Now before things become too abstract, let us pass on to the 

FIGURE 57. The idea of "chunking": a group of items is reperceived as a single "chunk". 
The chunk's boundary is a little like a cell membrane or a national border: it establishes 
a separate identity for the cluster within. According to context, one may wish to ignore 
the chunk's internal structure or to take it into account. 

concrete facts about computers, beginning with a very quick skim of what a computer 
system is like on the lowest level. The lowest level? Well, not really, for I am not going 
to talk about elementary particles-but it is the lowest level which we wish to think about. 

At the conceptual rock-bottom of a computer, we find a memory, a central 
processing unit (CPU), and some input-output (I/O) devices. Let us first describe the 
memory. It is divided up into distinct physical pieces, called words. For the sake of 
concreteness, let us say there are 65,536 words of memory (a typical number, being 2 to 
the 16th power). A word is further divided into what we shall consider the atoms of 
computer science-bits. The number of bits in a typical word might be around thirty-six. 
Physically, a bit is just a magnetic "switch" that can be in either of two positions. 



( > 




1 1 

1 1 


■■ > 






i 1 



1 1 


oj 0 

■ i 


— a word of 36 bits — 

Levels of Description, and Computer Systems 294 

you could call the two positions "up" and "down", or "x" and "o", o and "0" ... The third 
is the usual convention. It is perfectly fine, but i the possibly misleading effect of making 
people think that a comp deep down, is storing numbers. This is not true. A set of thirty- 
six bits not have to be thought of as a number any more than two bits has i thought of as 
the price of an ice cream cone. Just as money can do va things depending on how you use 
it, so a word in memory can serve r functions. Sometimes, to be sure, those thirty-six bits 
will indeed repn a number in binary notation. Other times, they may represent thin dots 
on a television screen. And other times, they may represent a letters of text. How a word 
in memory is to be thought of depends eni on the role that this word plays in the program 
which uses it. It ma course, play more than one role-like a note in a canon. 

Instructions and Data 

There is one interpretation of a word which I haven't yet mentioned, that is as an 
instruction. The words of memory contain not only data t acted on, but also the program 
to act on the data. There exists a lin repertoire of operations which can be carried out by 
the central proce5 unit-the CPU-and part of a word, usually its first several bits-is it 
pretable as the name of the instruction-type which is to be carried What do the rest of the 
bits in a word-interpreted-as-instruction stand Most often, they tell which other words in 
memory are to be acted upoi other words, the remaining bits constitute a pointer to some 
other wor( words) in memory. Every word in memory has a distinct location, li house on 
a street; and its location is called its address. Memory may have "street", or many 
"streets"-they are called "pages". So a given wo addressed by its page number (if memory 
is paged) together wit position within the page. Hence the "pointer" part of an instruction 
i numerical address of some word(s) in memory. There are no restric on the pointer, so an 
instruction may even "point" at itself, so that whet executed, it causes a change in itself to 
be made. 

How does the computer know what instruction to execute at any € time? This is kept 
track of in the CPU. The CPU has a special pointer w points at (i.e., stores the address of) 
the next word which is to be inter ed as an instruction. The CPU fetches that word from 
memory, and c it electronically into a special word belonging to the CPU itself. (Wor the 
CPU are usually not called "words", but rather, registers.) Then the executes that 
instruction. Now the instruction may call for any of a number of types of operations to be 
carried out. Typical ones include: 

ADD the word pointed to in the instruction, to a register. 

(In this case, the word pointed to is obviously interpreted as number.) 

Levels of Description, and Computer Systems 


PRINT the word pointed to in the instruction, as letters. 
(In this case, the word is obviously interpreted not as a number, but as a 
string of letters.) 

JUMP to the word pointed to in the instruction. 

(In this case, the CPU is being told to interpret that particular word as its 
next instruction.) 

Unless the instruction explicitly dictates otherwise, the CPU will pick up 
the very next word and interpret it as an instruction. In other words, the CPU 
assumes that it should move down the "street" sequentially, like a mailman, 
interpreting word after word as an instruction. But this sequential order can be 
broken by such instructions as the JUMP instruction, and others. 

Machine Language vs. Assembly language 

This is a very brief sketch of machine language. In this language, the types of 
operations which exist constitute a finite repertoire which cannot be extended. 
Thus all programs, no matter how large and complex, must be made out of 
compounds of these types of instructions. Looking at a program written in 
machine language is vaguely comparable to looking at a DNA molecule atom by 
atom. If you glance back to Fig. 41, showing the nucleotide sequence of a DNA 
molecule—and then if you consider that each nucleotide contains two dozen atoms 
or so-and if you imagine trying to write the DNA, atom by atom, for a small virus 
(not to mention a human being !)-then you will get a feeling for what it is like to 
write a complex program in machine language, and what it is like to try to grasp 
what is going on in a program if you have access only to its machine language 
description. , 

It must be mentioned, however, that computer programming was 
originally done on an even lower level, if possible, than that of machine language- 
-namely, connecting wires to each other, so that the proper operations were "hard- 
wired" in. This is so amazingly primitive by modern standards that it is painful 
even to' imagine. Yet undoubtedly the people who first did it experienced as much 
exhilaration as the pioneers of modern computers ever do .. . 

We now wish to move to a higher level of the hierarchy of levels of 
description of programs. This is the assembly language level. There is not a 
gigantic spread between assembly language and machine language; indeed, the 
step is rather gentle. In essence, there is a one-to-one correspondence between 
assembly language instructions and machine language instructions. The idea of 
assembly language is to "chunk" the individual machine language instructions, so 
that instead of writing the sequence of bits "010111000" when you want an 
instruction which adds one number to another, you simply write ADD, and then 
instead of giving the address in binary representation, you can refer to the word in 
memory by a name. 

Levels of Description, and Computer Systems 


Therefore, a program in assembly language is very much like a machine language 
program made legible to humans. You might compare the machine language 
version of a program to a TNT-derivation done in the obscure Godel-numbered 
notation, and the assembly language version to the isomorphic TNT-derivation, 
done in the original TNT-notation, which is much easier to understand. Or, going 
back to the DNA image, we can liken the difference between machine language 
and assembly language to the difference between painfully specifying each 
nucleotide, atom by atom, and specifying a nucleotide by simply giving its name 
(i.e., 'A', 'G', 'C, or 'T'). There is a tremendous saving of labor in this very 
simple "chunking" operation, although conceptually not much has been changed. 

Programs That Translate Programs 

Perhaps the central point about assembly language is not its differences from 
machine language, which are not that enormous, but just the key idea that 
programs could be written on a different level at all\ Just think about it: the 
hardware is built to "understand" machine language programs-sequences of bits- 
but not letters and decimal numbers. What happens when hardware is fed a 
program in assembly language% It is as if you tried to get a cell to accept a piece 
of paper with the nucleotide sequence written out in letters of the alphabet, instead 
of in chemicals. What can a cell do with a piece of paper? What can a computer 
do with an assembly language program? 

And here is the vital point: someone can write, in machine language, a 
translation program. This program, called an assembler, accepts mnemonic 
instruction names, decimal numbers, and other convenient abbreviations which a 
programmer can remember easily, and carries out the conversion into the 
monotonous but critical bit-sequences. After the assembly language program has 
been assembled (i.e., translated), it is run-ox rather, its machine language 
equivalent is run. But this is a matter of terminology. Which level program is 
running? You can never go wrong if you say that the machine language program 
is running, for hardware is always involved when any program runs-but it is also 
quite reasonable to think of the running program in terms of assembly language. 
For instance, you might very well say, "Right now, the CPU is executing a JUMP 
instruction", instead of saying, "Right now, the CPU is executing a ' 1 11010000' 
instruction". A pianist who plays the notes G-E-B E-G-B is also playing an 
arpeggio in the chord of E minor. There is no reason to be reluctant about 
describing things from a higher-level point of view. So one can think of the 
assembly language program running concurrently with the machine language 
program. We have two modes of describing what the CPU is doing. 

Levels of Description, and Computer Systems 


Higher-Level Languages, Compilers, and Interpreters 

The next level of the hierarchy carries much further the extremely powerful idea 
of using the computer itself to translate programs from a high level into lower 
levels. After people had programmed in assembly language for a number of years, 
in the early 1950's, they realized that there were a number of characteristic 
structures which kept reappearing in program after program. There seemed to be, 
just as in chess, certain fundamental patterns which cropped up naturally when 
human beings tried to formulate algorithms—exact descriptions of processes they 
wanted carried out. In other words, algorithms seemed to have certain higher- 
level components, in terms of which they could be much more easily and 
esthetically specified than in the very restricted machine language, or assembly 
language. Typically, a high-level algorithm component consists not of one or two 
machine language instructions, but of a whole collection of them, not necessarily 
all contiguous in memory. Such a component could be represented in a higher- 
level language by a single item-a chunk. 

Aside from standard chunks-the newly discovered components out of 
which all algorithms can be built-people realized that almost all programs contain 
even larger chunks-superchunks, so to speak. These superchunks differ from 
program to program, depending on the kinds of high-level tasks the j program is 
supposed to carry out. We discussed superchunks in Chapter V, calling them by 
their usual names: "subroutines" and "procedures". It was clear that a most 
powerful addition to any programming language would be the ability to define 
new higher-level entities in terms of previously known ones, and then to call them 
by name. This would build the chunking operation right into the language. Instead 
of there being a determinate repertoire of instructions out of which all programs 
had to be explicitly assembled, the programmer could construct his own modules, 
each with its own name, each usable anywhere inside the program, just as if it had 
been a built-in feature of the language. Of course, there is no getting away from 
the fact that down below, on a machine language level, everything would still be 
composed of the same old machine language instructions, but that would not be 
explicitly visible to the highlevel programmer; it would be implicit. 

The new languages based on these ideas were called compiler languages. 
One of the earliest and most elegant was called "Algol", for "Algorithmic 
Language". Unlike the case with assembly language, there is no straightforward 
one-to-one correspondence between statements in Algol and machine language 
instructions. To be sure, there is still a type of mapping from Algol into machine 
language, but it is far more "scrambled" than that between assembly language and 
machine language. Roughly speaking, an Algol program is to its machine 
language translation as a word problem in an elementary algebra text is to the 
equation it translates into. (Actually, getting from a word problem to an equation 
is far more complex, but it gives some inkling of the types of "unscrambling" that 
have to be carried out in translating from a high-level language to a lower-level 

Levels of Description, and Computer Systems 


guage.) In the mid-1950's, successful programs called compilers were written 
whose function was to carry out the translation from compiler languages to 
machine language. 

Also, interpreters were invented. Like compilers, interpreters translate 
from high-level languages into machine language, but instead of translating all the 
statements first and then executing the machine code, they read one line and' 
execute it immediately. This has the advantage that a user need not have written a 
complete program to use an interpreter. He may invent his program line by line, 
and test it out as he goes along. Thus, an interpreter is to a compiler as a 
simultaneous interpreter is to a translator of a written speech. One of the most 
important and fascinating of all computer languages is LISP (standing for "List 
Processing"), which was invented by John McCarthy around the time Algol was 
invented. Subsequently, LISP has enjoyed great popularity with workers in 
Artificial Intelligence. 

There is one interesting difference between the way interpreters work and 
compilers work. A compiler takes input (a finished Algol program, for instance) 
and produces output (a long sequence of machine language instructions). At this 
point, the compiler has done its duty. The output is then given to the computer to 
run. By contrast, the interpreter is constantly running while the programmer types 
in one LISP statement after another, and each one gets executed then' and there. 
But this doesn't mean that each statement gets first translated, then executed, for 
then an interpreter would be nothing but a line-by-line compiler. Instead, in an 
interpreter, the operations of reading a new line, "understanding" it, and executing 
it are intertwined: they occur simultaneously. 

Here is the idea, expanded a little more. Each time a new line of LISP is 
typed in, the interpreter tries to process it. This means that the interpreter jolts into 
action, and certain (machine language) instructions inside it get executed. 
Precisely which ones get executed depends on the LISP statement itself, of 
course. There are many JUMP instructions inside the interpreter, so that the new 
line of LISP may cause control to move around in a complex way-forwards, 
backwards, then forwards again, etc.. Thus, each LISP statement gets converted 
into a "pathway" inside the interpreter, and the act of following that pathway 
achieves the desired effect. 

Sometimes it is helpful to think of the LISP statements as mere pieces of 
data which are fed sequentially to a constantly running machine language 
program (the LISP interpreter). When you think of things this way, you get a 
different image of the relation between a program written in a higher-level 
language and the machine which is executing it. 


Of course a compiler, being itself a program, has to be written in some language. 
The first compilers were written in assembly language, rather than machine 
language, thus taking full advantage of the already ac- 

Levels of Description, and Computer Systems 


omplished first step up from machine language. A summary of these rather tricky 
concepts is presented in Figure 58. 

Now as sophistication increased, people realized that a partially written compiler 
could be used to compile extensions of itself. In other words, once i certain 
minimal core of a compiler had been written, then that minimal compiler could 
translate bigger compilers into machine language-which n turn could translate yet 
bigger compilers, until the final, full-blown xompiler had been compiled. This 
process is affectionately known as , bootstrapping"-for obvious reasons (at least if 
your native language is English it is obvious). It is not so different from the 
attainment by a child of a critical level of fluency in his native language, from 
which point on his 'vocabulary and fluency can grow by leaps and bounds, since 
he can use language to acquire new language. 

Compiler languages typically do not reflect the structure of the machines which 
will run programs written in them. This is one of their chief advantages over the 
highly specialized assembly and machine languages. Of course, when a compiler 
language program is translated into machine language, the resulting program is 
machine-dependent. Therefore one can describe a program which is being 
executed in a machine-independent way or a machine-dependent way. It is like 
referring to a paragraph in a book by its subject matter (publisher-independent), or 
its page number and position on the page (publisher-dependent). 

As long as a program is running correctly, it hardly matters how you 
describe it or think of its functioning. It is when something goes wrong that 


FIGURE 58. Assemblers and 
compilers are both translators into 
machine language. This is indicated 
by the solid lines. Moreover, since 
they are themselves programs, they 
are originally written in a language 
also. The wavy lines indicate that aa 
compiler can be written in assembly 
language, and an assembler in 
machine language. 

Levels on Which to Describe Running Programs 

Levels of Description, and Computer Systems 


it is important to be able to think on different levels. If, for instance, the machine 
is instructed to divide by zero at some stage, it will come to a halt and let the user 
know of this problem, by telling where in the program the questionable event 
occurred. However, the specification is often given on a lower level than that in 
which the programmer wrote the program. Here are three parallel descriptions of 
a program grinding to a halt: 

Machine Language Level: 

"Execution of the program stopped in location 111 00 10101110111" 

Assembly Language Level*: 

"Execution of the program stopped when the DIV (divide) instruction was 

Compiler Language Level: 

"Execution of the program stopped during evaluation of the algebraic 
expression "(A + B)/Z' 

One of the greatest problems for systems programmers (the people who write 
compilers, interpreters, assemblers, and other programs to be used by many 
people) is to figure out how to write error-detecting routines in such a way that 
the messages which they feed to the user whose program has a "bug" provide 
high-level, rather than low-level, descriptions of the problem. It is an interesting 
reversal that when something goes wrong in a genetic "program" (e.g., a 
mutation), the "bug" is manifest only to people on a high level-namely on the 
phenotype level, not the genotype level. Actually, modern biology uses mutations 
as one of its principal windows onto genetic processes, because of their multilevel 

Microprogramming and Operating Systems 

In modern computer systems, there are several other levels of the hierarchy. For 
instance, some systems-often the so-called "microcomputers" come with machine 
language instructions which are even more rudimentary than the instruction to add 
a number in memory to a number in a register. It is up to the user to decide what 
kinds of ordinary machine-level instructions he would like to be able to program 
in; he "microprograms" these instructions in terms of the "micro-instructions" 
which are available. Then the "higher-level machine language" instructions which 
he has designed may be burned into the circuitry and become hard-wired, 
although they need not be. Thus microprogramming allows the user to step a little 
below the conventional machine language level. One of the consequences is that a 
computer of one manufacturer can be hard-wired (via microprogramming) so as 
to have the same machine language instruction set as a computer of the same, or 
even another, manufacturer. The microprogrammed computer is said to be 
"emulating" the other computer. Then there is the level of the operating system, 
which fits between the 

Levels of Description, and Computer Systems 


machine language program and whatever higher level the user is programming in. 
The operating system is itself a program which has the functions of shielding the 
bare machine from access by users (thus protecting the system), and also of 
insulating the programmer from the many extremely intricate and messy problems 
of reading the program, calling a translator, running the translated program, 
directing the output to the proper channels at the proper time, and passing control 
to the next user. If there are several users "talking" to the same CPU at once, then 
the operating system is the program that shifts attention from one to the other in 
some orderly fashion. The complexities of operating systems are formidable 
indeed, and I shall only hint at them by the following analogy. 

Consider the first telephone system. Alexander Graham Bell could phone 
his assistant in the next room: electronic transmission of a voice! Now that is like 
a bare computer minus operating system: electronic computation! Consider now a 
modern telephone system. You have a choice of other telephones to connect to. 
Not only that, but many different calls can be handled simultaneously. You can 
add a prefix and dial into different areas. You can call direct, through the 
operator, collect, by credit card, person-to-person, on a conference call. You can 
have a call rerouted or traced. You can get a busy signal. You can get a siren-like 
signal that says that the number you dialed isn't "well-formed", or that you have 
taken too in long in dialing. You can install a local switchboard so that a group of 
phones are all locally connected—etc, etc. The list is amazing, when you think of 
how much flexibility there is, particularly in comparison to the erstwhile miracle 
of a "bare" telephone. Now sophisticated operating systems carry out similar 
traffic-handling and level-switching operations with respect to users and their 
programs. It is virtually certain that there are somewhat parallel things which take 
place in the brain: handling of many stimuli at the same time; decisions of what 
should have priority over what and for how long; instantaneous "interrupts" 
caused by emergencies or other unexpected occurrences; and so on. 

Cushioning the User and Protecting the System 

The many levels in a complex computer system have the combined effect of 
"cushioning" the user, preventing him from having to think about the many lower- 
level goings-on which are most likely totally irrelevant to him anyway. A 
passenger in an airplane does not usually want to be aware of the levels of fuel in 
the tanks, or the wind speeds, or how many chicken dinners are to be served, or 
the status of the rest of the air traffic around the destination-this is all left to 
employees on different levels of the airlines hierarchy, and the passenger simply 
gets from one place to another. Here again, it is when something goes wrong-such 
as his baggage not arriving that the passenger is made aware of the confusing 
system of levels underneath him. 

Levels of Description, and Computer Systems 


Are Computers Super-Flexible or Super-Rigid? 

One of the major goals of the drive to higher levels has always been to make as 
natural as possible the task of communicating to the computer what you want it to 
do. Certainly, the high-level constructs in compiler languages are closer to the 
concepts which humans naturally think in, than are lower-level constructs such as 
those in machine language. But in this drive towards ease of communication, one 
aspect of "naturalness" has been quite neglected. That is the fact that interhuman 
communication is far less rigidly constrained than human-machine 
communication. For instance, we often produce meaningless sentence fragments 
as we search for the best way to express something, we cough in the middle of 
sentences, we interrupt each other, we use ambiguous descriptions and "improper" 
syntax, we coin phrases and distort meanings-but our message still gets through, 
mostly. With programming languages, it has generally been the rule that there is a 
very strict syntax which has to be obeyed one hundred per cent of the time; there 
are no ambiguous words or constructions. Interestingly, the printed equivalent of 
coughing (i.e., a nonessential or irrelevant comment) is allowed, but only 
provided it is signaled in advance by a key word (e.g., COMMENT), and then 
terminated by another key word (e.g., a semicolon). This small gesture towards 
flexibility has its own little pitfall, ironically: if a semicolon (or whatever key 
word is used for terminating a comment) is used inside a comment, the translating 
program will interpret that semicolon as signaling the end of the comment, and 
havoc will ensue. 

If a procedure named INSIGHT has been defined and then called seventeen times 
in the program, and the eighteenth time it is misspelled as INSIHGT, woe to the 
programmer. The compiler will balk and print a rigidly unsympathetic error 
message, saying that it has never heard of INSIHGT. Often, when such an error 
is detected by a compiler, the compiler tries to continue, but because of its lack of 
insihgt, it has not understood what the programmer meant. In fact, it may very 
well suppose that something entirely different was meant, and proceed under that 
erroneous assumption. Then a long series of error messages will pepper the rest of 
the program, because the compiler-not the programmer-got confused. Imagine the 
chaos that would result if a simultaneous English-Russian interpreter, upon 
hearing one phrase of French in the English, began trying to interpret all the 
remaining English as French. Compilers often get lost in such pathetic ways. C'est 
la vie. 

Perhaps this sounds condemnatory of computers, but it is not meant to be. In some 
sense, things had to be that way. When you stop to think what most people use 
computers for, you realize that it is to carry out very definite and precise tasks, 
which are too complex for people to do. If the computer is to be reliable, then it is 
necessary that it should understand, without the slightest chance of ambiguity, 
what it is supposed to do. It is also necessary that it should do neither more nor 
less than it is explicitly instructed to do. If there is, in the cushion underneath the 
programmer, a program whose purpose is to "guess" what the programmer wants 

Levels of Description, and Computer Systems 


means, then it is quite conceivable that the programmer could try to communicate 
his task and be totally misunderstood. So it is important that the high-level 
program, while comfortable for the human, still should be unambiguous and 

Second-Guessing the Programmer 

Now it is possible to devise a programming language-and a program which 
translates it into the lower levels-which allows some sorts of imprecision. One 
way of putting it would be to say that a translator for such a programming 
language tries to make sense of things which are done "outside of the rules of the 
language". But if a language allows certain "transgressions", then transgressions 
of that type are no longer true transgressions, because they have been included 
inside the rules' If a programmer is aware that he may make certain types of 
misspelling, then he may use this feature of the language deliberately, knowing 
that he is actually operating within the rigid rules of the language, despite 
appearances. In other words, if the user is aware of all the flexibilities 
programmed into the translator for his convenience, then he knows the bounds 
which he cannot overstep, and therefore, to him, the translator still appears rigid 
and inflexible, although it may allow him much more freedom than early versions 
of the language, which did not incorporate "automatic compensation for human 

With "rubbery" languages of that type, there would seem to be two 
alternatives: (1) the user is aware of the built-in flexibilities of the language and 
its translator; (2) the user is unaware of them. In the first case, the language is still 
usable for communicating programs precisely, because the programmer can 
predict how the computer will interpret the programs he writes in the language. In 
the second case, the "cushion" has hidden features which may do things that are 
unpredictable (from the vantage point of a user who doesn't know the inner 
workings of the translator). This may result in gross misinterpretations of 
programs, so such a language is unsuitable for purposes where computers are used 
mainly for their speed and reliability. 

Now there is actually a third alternative: (3) the user is aware of the built- 
in flexibilities of the language and its translator, but there are so many of them 
and they interact with each other in such a complex way that he cannot tell how 
his programs will be interpreted. This may well apply to the person who wrote the 
translating program; he certainly knows its insides as well as anyone could-but he 
still may not be able to anticipate how it will react to a given type of unusual 

One of the major areas of research in Artificial Intelligence today is called 
automatic programming, which is concerned with the development of yet higher- 
level languages-languages whose translators are sophisticated, in that they can do 
at least some of the following impressive things: generalize from examples, 
correct some misprints or grammatical errors, 

Levels of Description, and Computer Systems 


try to make sense of ambiguous descriptions, try to second-guess the user by 
having a primitive user model, ask questions when things are unclear, use English 
itself, etc. The hope is that one can walk the tightrope between reliability and 

AI Advances Are Language Advances 

It is striking how tight the connection is between progress in computer science 
(particularly Artificial Intelligence) and the development of new languages. A 
clear trend has emerged in the last decade: the trend to consolidate new types of 
discoveries in new languages. One key for the understanding and creation of 
intelligence lies in the constant development and refinement of the languages in 
terms of which processes for symbol manipulation are describable. Today, there 
are probably three or four dozen experimental languages which have been 
developed exclusively for Artificial Intelligence research. It is important to realize 
that any program which can be written in one of these languages is in principle 
programmable in lower-level languages, but it would require a supreme effort for 
a human; and the resulting program would be so long that it would exceed the 
grasp of humans. It is not that each higher level extends the potential of the 
computer; the full potential of the computer already exists in its machine language 
instruction set. It is that the new concepts in a high-level language suggest 
directions and perspectives by their very nature. 

The "space" of all possible programs is so huge that no one can have a 
sense of what is possible. Each higher-level language is naturally suited for 
exploring certain regions of "program space"; thus the programmer, by using that 
language, is channeled into those areas of program space. He is not forced by the 
language into writing programs of any particular type, but the language makes it 
easy for him to do certain kinds of things. Proximity to a concept, and a gentle 
shove, are often all that is needed for a major discovery-and that is the reason for 
the drive towards languages of ever higher levels. 

Programming in different 'languages is like composing pieces in different 
keys, particularly if you work at the keyboard. If you have learned or written 
pieces in many keys, each key will have its own special emotional aura. Also, 
certain kinds of figurations "lie in the hand" in one key but are awkward in 
another. So you are channeled by your choice of key. In some ways, even 
enharmonic keys, such as C-sharp and D-flat, are quite distinct in feeling. This 
shows how a notational system can play a significant role in shaping the final 

A "stratified" picture of Al is shown in Figure 59, -with machine 
components such as transistors on the bottom, and "intelligent programs" on the 
top. The picture is taken from the book Artificial Intelligence by Patrick Henry 
Winston, and it represents a vision of Al shared by nearly all Al workers. 
Although I agree with the idea that Al must be stratified in some such way, I do 
not think that, with so few layers, intelligent programs 

Levels of Description, and Computer Systems 


FIGURE 59. To create intelligent 
programs, one needs to build up a series 
of levels of hardware and software, so 
that one is spared the agonT of seeing 
everything only on the lowest level. 
Descriptions of a single process on 
different levels will sound verb different 
from each other, only the top one being 
sufficiently chunked that it is 
comprehensible to us. [Adapted from P. 
H. Winston, Artificial Intelligence 
(Reading, Mass.: Addison-ifele", 1977)] 

can he reached. Between the machine language level and the level where rue 
intelligence will be reached, I am convinced there will lie perhaps mother dozen 
(or even several dozen!) layers, each new layer building on and extending the 
flexibilities of the layer below. What they will be like we can hardly dream of 
now ... 

The Paranoid and the Operating System 

The similarity of all levels in a computer system can lead to some strange level- 
mixing experiences. I once watched a couple of friends-both computer novices- 
playing with the program "PARRY" on a terminal. PARRY s a. rather infamous 
program which simulates a paranoid in an extremely rudimentary way, by spitting 
out canned phrases in English chosen from a vide repertoire; its plausibility is due 
to its ability to tell which of its stock phrases might sound reasonable in response 
to English sentences typed to t by a human. 

At one point, the response time got very sluggish-PARRY was taking very 
long to reply-and I explained to my friends that this was probably because of the 
heavy load on the time-sharing system. I told them they could find out how many 
users were logged on, by typing a special "control" character which would go 
directly to the operating system, and would )e unseen by PARRY. One of my 
friends pushed the control character. In a lash, some internal data about the 
operating system's status overwrote some of PARRY's words on the screen. 
PARRY knew nothing of this: it is a program with "knowledge" only of horse 
racing and bookies-not operating systems and terminals and special control 
characters. But to my friends, both PARRY and the operating system were just 
"the computer"-a mysterious, remote, amorphous entity that responded to them 
when they typed. And so it made perfect sense when one of them blithely typed, 
in 3nglish, "Why are you overtyping what's on the screen?" The idea that PARRY 
could know' nothing about the operating system it was running 








Levels of Description, and Computer Systems 


under was not clear to my friends. The idea that "you" know all about "yourself 
is so familiar from interaction with people that it was natural to extend it to the 
computer-after all, it was intelligent enough that it could "talk" to them in 
English! Their question was not unlike asking a person, "Why are you making so 
few red blood cells today?" People do not know about that level-the "operating 
system level" -of their bodies. 

The main cause of this level-confusion was that communication with all 
levels of the computer system was taking place on a single screen, on a single 
terminal. Although my friends' naivete might seem rather extreme, even 
experienced computer people often make similar errors when several levels of a 
complex system are all present at once on the same screen. They forget "who" 
they are talking to, and type something which makes no sense at that level, 
although it would have made perfect sense on another level. It might seem 
desirable, therefore, to have the system itself sort out the levels-to interpret 
commands according to what "makes sense". Unfortunately, such interpretation 
would require the system to have a lot of common sense, as well as perfect 
knowledge of the programmer's overall intent-both of which would require more 
artificial intelligence than exists at the present time. 

The Border between Software and Hardware 

One can also be confused by the flexibility of some levels and the rigidity of 
others. For instance, on some computers there are marvelous text-editing systems 
which allow pieces of text to be "poured" from one format into another, 
practically as liquids can be poured from one vessel into another. A thin page can 
turn into a wide page, or vice versa. With such power, you might expect that it 
would be equally trivial to change from one font to another-say from roman to 
italics. Yet there may be only a single font available on the screen, so that such 
changes are impossible. Or it may be feasible on the screen but not printable by 
the printer-or the other way around. After dealing with computers for a long time, 
one gets spoiled, and thinks that everything should be programmable: no printer 
should be so rigid as to have only one character set, or even a finite repertoire of 
them-typefaces should be user-specifiable! But once that degree of flexibility has 
been attained, then one may be annoyed that the printer cannot print in different 
colors of ink, or that it cannot accept paper of all shapes and sizes, or that it does 
not fix itself when it breaks ... 

The trouble is that somewhere, all this flexibility has to "bottom out", to 
use the phrase from Chapter V. There must be a hardware level which underlies it 
all, and which is inflexible. It may lie deeply hidden, and there may be so much 
flexibility on levels above it that few users feel the hardware limitations-but it is 
inevitably there. 

What is this proverbial distinction between software and hardware? It is 
the distinction between programs and machines-between long complicated 
sequences of instructions, and the physical machines which carry 

Levels of Description, and Computer Systems 


them out. I like to think of software as "anything which you could send over he 
telephone lines", and hardware as "anything else". A piano is hardware, gut 
printed music is software. A telephone set is hardware, but a telephone lumber is 
software. 'The distinction is a useful one, but not always so clear-cut. 

We humans also have "software" and "hardware" aspects, and the 
difference is second nature to us. We are used to the rigidity of our physiology: 
the fact that we cannot, at will, cure ourselves of diseases, or ;row hair of any 
color-to mention just a couple of simple examples. We an, however, "reprogram" 
our minds so that we operate in new conceptual frameworks. The amazing 
flexibility of our minds seems nearly irreconcilable with the notion that our brains 
must be made out of fixed-rule hardware, which cannot be reprogrammed. We 
cannot make our neurons ire faster or slower, we cannot rewire our brains, we 
cannot redesign the interior of a neuron, we cannot make anti choices about the 
hardware-and 'et, we can control how we think. 

But there are clearly aspects of thought which are beyond our control. We 
cannot make ourselves smarter by an act of will; we cannot learn a new language 
as fast as we want; we cannot make ourselves think faster than we lo; we cannot 
make ourselves think about several things at once; and so on. This is a kind of 
primordial self-knowledge which is so obvious that it is lard to see it at all; it is 
like being conscious that the air is there. We never really bother to think about 
what might cause these "defects" of our minds: lamely, the organization of our 
brains. To suggest ways of reconciling the software of mind with the hardware of 
brain is a main goal of this book. 

Intermediate Levels and the Weather 

We have seen that in computer systems, there are a number of rather sharply 
defined strata, in terms of any one of which the operation of a running program 
can be described. Thus there is not merely a single low bevel and a single high 
level-there are all degrees of lowness and highness, s the existence of intermediate 
levels a general feature of systems which lave low and high levels? Consider, for 
example, the system whose 'hardware" is the earth's atmosphere (not very hard, 
but no matter), and whose "software" is the weather. Keeping track of the motions 
of all of the molecules simultaneously would be a very low-level way of 
"understanding" he weather, rather like looking at a huge, complicated program 
on the machine language level. Obviously it is way beyond human 
comprehension. 3ut we still have our own peculiarly human ways of looking at, 
and describing, weather phenomena. Our chunked view of the weather is based >n 
very high-level phenomena, such as: rain, fog, snow, hurricanes, cold fronts, 
seasons, pressures, trade winds, the jet stream, cumulo-nimbus clouds, 
thunderstorms, inversion layers, and so on. All of these phenomena involve 
astronomical numbers of molecules, somehow behaving in concert o that large- 
scale trends emerge. This is a little like looking at the weather n a compiler 

Levels of Description, and Computer Systems 


Is there something analogous to looking at the weather in an intermediate- 
level language, such as assembly language? For instance, are there very small 
local "mini-storms", something like the small whirlwinds which one occasionally 
sees, whipping up some dust in a swirling column a few feet wide, at most? Is a 
local gust of wind an intermediate-level chunk which plays a role in creating 
higher-level weather phenomena? Or is there just no practical way of combining 
knowledge of such kinds of phenomena to create a more comprehensive 
explanation of the weather? 

Two other questions come to my mind. The first is: "Could it be that the 
weather phenomena which we perceive on our scale-a tornado, a drought-are just 
intermediate-level phenomena: parts of vaster, slower phenomena?" If so, then 
true high-level weather phenomena would be global, and their time scale would 
be geological. The Ice Age would be a high-level weather event. The second 
question is: "Are there intermediate level weather phenomena which have so far 
escaped human perception, but which, if perceived, could give greater insight into 
why the weather is as it is?" 

From Tornados to Quarks 

This last suggestion may sound fanciful, but it is not all that far-fetched. 
We need only look to the hardest of the hard sciences-physics-to find peculiar 
examples of systems which are explained in terms of interacting "parts" which are 
themselves invisible. In physics, as in any other discipline, a system is a group of 
interacting parts. In most systems that we know, the parts retain their identities 
during the interaction, so that we still see the parts inside the system. For 
example, when a team of football players assembles, the individual players retain 
their separateness-they do not melt into some composite entity, in which their 
individuality is lost. Still-and this is important-some processes are going on in 
their brains which are evoked by the team-context, and which would not go on 
otherwise, so that in a minor way, the players change identity when they become 
part of the larger system, the team. This kind of system is called a nearly 
decomposable system (the term comes from H. A. Simon's article "The 
Architecture of Complexity"; see the Bibliography). Such a system consists of 
weakly interacting modules, each of which maintains its own private identity 
throughout the interaction but by becoming slightly different from how it is when 
outside of the system,, contributes to the cohesive behavior of the whole system. 
The systems studied in physics are usually of this type. For instance, an atom is 
seen as made of 'a nucleus whose positive charge captures a number of electrons 
in "orbits", or bound states. The bound electrons are very much like free electrons, 
despite their being internal to a composite object. 

Some systems studied in physics offer a contrast to the relatively 
straightforward atom. Such systems involve extremely strong interactions, as a 
result of which the parts are swallowed up into the larger system, and lose some 
or all of their individuality. An example of this is the nucleus of an atom, which is 
usually described as being "a collection of protons and 

Levels of Description, and Computer Systems 


neutrons". But the forces which pull the component particles together are strong 
that the component particles do not survive to anything like their "free" form (the 
form they have when outside a nucleus). And in fact a nucleus acts in many ways 
as a single particle, rather than as a collection of interacting particles. When a 
nucleus is split, protons and neutrons are ten released, but also other particles, 
such as pi-mesons and gamma rays, are commonly produced. Are all those 
different particles physically present side a nucleus before it is split, or are then 
just "sparks" which fly off ten the nucleus is split- It is perhaps not meaningful to 
try to give an answer to such a question. On the level of particle physics, the 
difference between storing the potential to make "sparks" and storing actual sub 
particles is not so clear. 

A nucleus is thus one systems whose "parts!, even though they are not 
visible while on the inside, can be pulled out and made risible. However, ere are 
more pathological cases, such as the proton and neutron seen as stems themselves. 
Each of them has been hypothesized to be constituted from a trio of "quarks"- 
hypothetical particles which can be combined in twos or threes to make many 
known fundamental particles. However, the interaction between quarks is so 
strong that not only can they not he seen [side the proton and neutron, but they 
cannot even be pulled out at all', bus, although quarks help to give a theoretical 
understanding of certain properties of protons and neutrons, their own existence 
may perhaps ever be independently established. Here see have the antithesis of a 
nearly decomposable system"-it is a system which, if anything, is "nearly 
indecomposable", Yet what is curious is that a quark-based theory of rotors and 
neutrons (and other particles) has considerable explanatory power, in that many 
experimental results concerning the particles which narks supposedly compose 
can be accounted for quite well, quantitatively, by using the "quark model". 

Superconductivity: A "Paradox" of Renormalization 

In Chapter V we discussed how renormalized particles emerge from their bare 
cores, by recursively compounded interactions with virtual particles. A 
renormalized particle can be seen either as this complex mathematical construct, 
or as the single lump which it is, physically. One of the strangest rid most 
dramatic consequences of this way of describing particles is the explanation it 
provides for the famous phenomenon of superconductivity resistance-free flow of 
electrons in certain solids, at extremely low temperatures. 

It turns out that electrons in solids are renormalized by their interactions 
with strange quanta of vibration called phonons (themselves renormalized as 
well!). These renormalized electrons are called polarons. Calculation shows that 
at very low temperatures, two oppositely spinning polarons sill begin to attract 
each other, and can actually become bound together in i certain way. Under the 
proper conditions, all the current-carrying polar 

Levels of Description, and Computer Systems 


ons will get paired up, forming Cooper pains. Ironically, this pairing comes about 
precisely because electrons-the hare cores of the paired polarons—repel each other 
electrically. In contrast to the electrons, each Cooper pair feels neither attracted to 
nor repelled by an other Cooper pair, and consequently it can slip freely through a 
metal as if the metal were a vacuum. If you convert the mathematical description 
of such a metal from one whose primitive units are polarons into one whose 
primitive units are Cooper pairs, you get a considerable- simplified set of 
equations. This mathematical simplicity is the physicist's way of knowing that 
"chunking" into Cooper pairs is the natural way to look at superconductivity. 

Here we have several levels of particle: the Cooper pair itself: the two 
oppositely-spinning polarons which compose it: the electrons and phonons which 
make up the polarons: and then, within the electrons, the virtual photons and 
positrons, etc. etc. We can look at each level and perceive phenomena there, 
which are explained by an understanding of the levels below. 


Similarly, and fortunately, one does not have to know all about quarks to 
understand many things about the particles which they may compose. Thus, a 
nuclear physicist can proceed with theories of nuclei that are based on protons and 
neutrons, and ignore quark theories and their rivals. The nuclear physicist has a 
chunked picture of protons and neutrons-a description derived from lower-level 
theories buf which does not require understanding the lower-level theories. 
Likewise, an atomic physicist has a chunked picture of an atomic nucleus derived 
from nuclear theory. Then a chemist has a chunked picture of the electrons and 
their orbits, and builds theories of small molecules, theories which can be taken 
over in a chunked way by the molecular biologist, who has an intuition for how 
small molecules hang together, but whose technical expertise is in the field of 
extremely large molecules and how they interact. Then the cell biologist has a 
chunked picture of the units which the molecular biologist pores over, and tries to 
use them to account for the ways that cells interact. The point is clear. Each level 
is, in some sense, "sealed off from the levels below it. This is another of Simon's 
vivid terms, recalling the way in which a submarine is built in compartments, so 
that if one part is damaged, and water begins pouring in, the trouble can be 
prevented from spreading, by closing the doors, thereby sealing off the damaged 
compartment from neighboring compartments. 

Although there is always some "leakage" between the hierarchical levels 
of science, so that a chemist cannot afford to ignore lower-level physics totally, or 
a biologist to ignore chemistry totally, there is almost no leakage from one level 
to a distant level. That is why people earl, have intuitive understandings of other 
people without necessarily understanding the quark model, the structure of nuclei, 
the nature of electron orbits, 

Levels of Description, and Computer Systems 


the chemical bond, the structure of proteins, the organelles in a cell, the methods 
of intercellular communication, the physiology 'of the various organs of the 
human body, or the complex interactions among organs. All at a person needs is a 
chunked model of how the highest level acts; and as all know, such models are 
very realistic and successful. 

The Trade-off between Chunking and Determinism 

There is, however, perhaps one significant negative feature of a chunked model: it 
usually does not have exact predictive power. That is, we save ourselves from the 
impossible task of seeing people as collections of quarks (or whatever is at the 
lowest level) by using chunked models: but of course such models only give us 
probabilistic estimates of how other people feel, will react to what we say or do, 
and so on. In short, in using chunked high-level models, we sacrifice determinism 
for simplicity. Despite not being sure how people will react to a joke, we tell it 
with the expectation at they will do something such as laugh, or not laugh-rather 
than, say, climb the nearest flagpole. (Zen masters might well do the latter!) A 
chunked model defines a "space" within which behavior is expected to fall, and 
specifies probabilities of its falling in different parts of that space. 

"Computers Can Only Do What You Tell Them to Do" 

Now these ideas can be applied as well to computer programs as to 
compose physical systems. There is an old saw which says, "Computers can only 
what you tell them to do." This is right in one sense, but it misses the hint: you 
don't know in advance the consequences of what you tell a computer to do; 
therefore its behavior can be as baffling and surprising id unpredictable to you as 
that of a person. You generally know in advance the space in which the output 
will fall, but you don't know details of here it will fall. For instance, you might 
write a program to calculate the first million digits of 7r. Your program will spew 
forth digits of 7r much faster than you can-but there is no paradox in the fact that 
the computer outracing its programmer. You know in advance the space in which 
the output will lie-namely the space of digits between 0 and 9-which is to say, )u 
have a chunked model of the program's behavior; but if you'd known ie rest, you 
wouldn't have written the program. 

There is another sense in which this old saw is rusty. This involves the ct 
that as you program in ever higher-level languages, you know less and ss 
precisely what you've told the computer to do! Layers and layers of translation 
may separate the "front end" of a complex program from the actual machine 
language instructions. At the level you think and program, your statements may 
resemble declaratives and suggestions more than they resemble imperatives or 
commands. And all the internal rumbling provoked by the input of a high-level 
statement is invisible to you, generally, just as when you eat a sandwich, you are 
spared conscious awareness of the digestive processes it triggers 

Levels of Description, and Computer Systems 


In any case, this notion that "computers can only do what they are told to 
do," first propounded by Lady Lovelace in her famous memoir, is so prevalent 
and so connected with the notion that "computers cannot think" that we shall 
return to it in later Chapters when our level of sophistication is greater. 

Two Types of System 

There is an important division between two types of system built up from many 
parts. There are those systems in which the behavior of some parts tends to cancel 
out the behavior of other parts, with the result that it does not matter too much 
what happens on the low level, because most anything will yield similar high- 
level behavior. An example of this kind of system is a container of gas, where all 
the molecules bump and bang against each other in very complex microscopic 
ways; but the total outcome, from a macroscopic point of view, is a very calm, 
stable system with a certain temperature, pressure, and volume. Then there are 
systems where the effect of a single low-level event may get magnified into an 
enormous high-level consequence. Such a system is a pinball machine, where the 
exact angle with which a ball strikes each post is crucial in determining the rest of 
its descending pathway. 

A computer is an elaborate combination of these two types of system. It 
contains subunits such as wires, which behave in a highly predictable fashion: 
they conduct electricity according to Ohm's law, a very precise, chunked law 
which resembles the laws governing gases in containers, since it depends on 
statistical effects in which billions of random effects cancel each other out, 
yielding a predictable overall behavior. A computer also contains macroscopic 
subunits, such as a printer, whose behavior is completely determined by delicate 
patterns of currents. What the printer prints is not by any means created by a 
myriad canceling microscopic effects. In fact, in the case of most computer 
programs, the value of every single bit in the program plays a critical role in the 
output that gets printed. If any bit were changed, the output would also change 

Systems which are made up of "reliable" subsystems only-that is, 
subsystems whose behavior can be reliably predicted from chunked descriptions- 
play inestimably important roles in our daily lives, because they are pillars of 
stability. We can rely on walls not to fall down, on sidewalks to go where they 
went yesterday, on the sun to shine, on clocks to tell the time correctly, and so on. 
Chunked models of such systems are virtually entirely deterministic. Of course, 
the other kind of system which plays a very large role in our lives is a system that 
has variable behavior which depends on some internal microscopic parameters- 
often a very large number of them, moreover-which we cannot directly observe. 
Our chunked model of such a system is necessarily in terms of the "space" of 
operation, and involves probabilistic estimates of landing in different regions of 
that space. 

A container of gas, which, as I already pointed out, is a reliable system 

Levels of Description, and Computer Systems 


Because of many canceling effects, obeys precise, deterministic laws of physics. 
Such laws are chunked laws, in that they deal with the gas as a whole, nd ignore 
its constituents. Furthermore, the microscopic and macroscopic descriptions of a 
gas use entirely different terms. The former requires the pacification of the 
position and velocity of every single component molecule; the latter requires only 
the specification of three new quantities: temperature, pressure, and volume, the 
first two of which do not even have microscopic counterparts. The simple 
mathematical relationship which elates these three parameters- pV = cT, where c 
is a constant-is a law which depends on, yet is independent of, the lower-level 
phenomena. Less paradoxically, this law can be derived from the laws governing 
the molecular level; in that sense it depends on the lower level. On the other hand, 
it is law which allows you to ignore the lower level completely, if you wish: in hat 
sense it is independent of the lower level. 

It is important to realize that the high-level law cannot be stated in the 
vocabulary of the low-level description. "Pressure" and "temperature" are new 
terms which experience with the low level alone cannot convey. We humans 
perceive temperature and pressure directly; that is how we are guilt, so that it is 
not amazing that we should have found this law. But creatures which knew gases 
only as theoretical mathematical constructs would have to have an ability to 
synthesize new concepts, if they were to discover this law. 


In drawing this Chapter to a close, I would like to relate a story about a complex 
system. I was talking one day with two systems programmers for he computer I 
was using. They mentioned that the operating system seemed to be able to handle 
up to about thirty-five users with great comfort, but at about thirty-five users or 
so, the response time all of a sudden hot up, getting so slow that you might as well 
log off and go home and wait until later. Jokingly I said, "Well, that's simple to fix 
just find the place in he operating system where the number '35' is stored, and 
change it to 60'!" Everyone laughed. The point is, of course, that there is no such 
place, where, then, does the critical number-35 users-come from? The answer is: 
It is a visible consequence of the overall system organization-an 

Similarly, you might ask about a sprinter, "Where is the "9.3' stored, hat 
makes him be able to run 100 yards in 9.3 seconds?" Obviously, it is not stored 
anywhere. His time is a result of how he is built, what his reaction time is, a 
million factors all interacting when he runs. The time is quite 'reproducible, but it 
is not stored in his body anywhere. It is spread around among all the cells of his 
body and only manifests itself in the act of the print itself. 

Epiphenomena abound. In the game of "Go", there is the feature that "two 
eyes live". It is not built into the rules, but it is a consequence of the 

Levels of Description, and Computer Systems 


rules. In the human brain, there is gullibility. How gullible are you? Is your 
gullibility located in some "gullibility center" in your brain? Could a 
neurosurgeon reach in and perform some delicate operation to lower your 
gullibility, otherwise leaving you alone? If you believe this, you are pretty 
gullible, and should perhaps consider such an operation. 

Mind vs. Brain 

In coming Chapters, where we discuss the brain, we shall examine whether the 
brain's top level-the mind-can be understood without understanding the lower 
levels on which it both depends and does not depend. Are there laws of thinking 
which are "sealed off from the lower laws that govern the microscopic activity in 
the cells of the brain? Can mind be "skimmed" off of brain and transplanted into 
other systems? Or is it impossible to unravel thinking processes into neat and 
modular subsystems? Is the brain more like an atom, a renormalized electron, a 
nucleus, a neutron, or a quark? Is consciousness an epiphenomenon? To 
understand the mind, must one go all the way down to the level of nerve cells? 

Levels of Description, and Computer Systems 


FIGURE 60. [Drawing by the author.) 

. Ant Fugue 

.... then, one by one, the four voices of the fugue chime in.) 

Achilles: I know the rest of you won't believe this, but the answer to the question is 
staring us all in the face, hidden in the picture. It is simply one word-but what an 
important one: "MU"! 

CCrab: I know the rest of you won't believe this, but the answer to the question is staring 
us all in the face, hidden in the picture. It is simply one word-but what an important 
one: "HOLISM"! 

Achilles: Now hold on a minute. You must be seeing things. It's plain as day that the 

message of this picture is "MU", not "HOLISM"! 
Crab: I beg your pardon, but my eyesight is extremely good. Please look again, and then 

tell me if the the picture doesn't say what I said it says! 
Anteater: I know the rest of you won't believe this, but the answer to the question is 

staring us all in the face, hidden in the picture. It is simply one word-but what an 

important one: "REDUCTIONISM"! 
Crab: Now hold on a minute. You must be seeing things. It's plain as day that the 

message of this picture is "HOLISM", not "REDUCTIONISM"! 
Achilles: Another deluded one! Not "HOLISM", not "REDUCTIONISM", but "MU" is 

the message of this picture, and that much is certain. 
Anteater: I beg your pardon, but my eyesight is extremely clear. Please look again, and 

then see if the picture doesn't say what I said it says. 
Achilles: Don't you see that the picture is composed of two pieces, and that each of them 

is a single letter? 

Crab: You are right about the two pieces, but you are wrong in your identification of 
what they are. The piece on the left is entirely composed of three copies of one word: 
"HOLISM"; and the piece on the right is composed of many copies, in smaller letters, 
of the same word. Why the letters are of different sizes in the two parts, I don't know, 
but I know what I see, and what I see is "HOLISM", plain as day. How you see 
anything else is beyond me. 

Anteater: You are right about the two pieces, but you are wrong in your identification of 
what they are. The piece on the left is entirely composed of many copies of one 
word: "REDUCTIONISM"; and the piece on the right is composed of one single 
copy, in larger letters, of the same word. Why the letters are of different sizes in the 
two parts, I don't know, but I know what I see, and what I see is 
"REDUCTIONISM", plain as day. How you see anything else is beyond me. 

Achilles: I know what is going on here. Each of you has seen letters which compose, or 
are composed of, other letters. In the left-hand piece, 

Ant Fugue 


there are indeed three "HOLISM"'s, but each one of them is composed out of smaller 
copies of the word "REDUCTIONISM". And in complementary fashion, in the right- 
hand piece, there is indeed one "REDUCTIONISM", but it is composed out of 
smaller copies of the word "HOLISM". Now this is all fine and good, but in your 
silly squabble, the two of you have actually missed the forest for the trees. You see, 
what good is it to argue about whether "HOLISM" or "REDUCTIONISM" is right, 
when the proper way to understand the matter is to transcend the question, by 
answering "Mu", 

Crab: I now see the picture as you have described it, Achilles, but I have no idea of what 
you mean by the strange expression "transcending the question". 

Anteater: I now see the picture as you have described it, Achilles, but I have no idea of 
what you mean by the strange expression "Mu". .illes: I will be glad to indulge both 
of you, if you will first oblige me, by telling me the meaning of these strange 
expressions, "HOLISM" and "REDUCTIONISM". 

Crab: HOLISM is the most natural thing in the world to grasp. It's simply the belief that 
"the whole is greater than the sum of its parts". No one in his right mind could reject 

Anteater: REDUCTIONISM is the most natural thing in the world to grasp. It's simply 
the belief that "a whole can be understood completely if you understand its parts, and 
the nature of their 'sum'". No one in her left brain could reject reductionism. 

Crab: I reject reductionism. I challenge you to tell me, for instance, how to understand a 
brain reductionistically. Any reductionistic explanation of a brain will inevitably fall 
far short of explaining where the consciousness experienced by a brain arises from. 

Anteater: I reject holism. I challenge you to tell me, for instance, how a holistic 
description of an ant colony sheds any more light on it than is shed by a description 
of the ants inside it, and their roles, and their interrelationships. Any holistic 
explanation of an ant colony will inevitably fall far short of explaining where the 
consciousness experienced by an ant colony arises from. 

Antilles: Oh, no! The last thing which I wanted to do was to provoke another argument. 
Anyway, now that I understand the controversy, I believe that my explanation of 
"Mu" will help greatly. You see, "Mu" is an ancient Zen answer which, when given 
to a question, UNASKS the question. Here, the question seems to be, "Should the 
world be understood via holism, or via reductionism?" And the answer of "Mu" here 
rejects the premises of the question, which are that one or the other must be chosen. 
By unasking the question, it reveals a wider truth: that there is a larger context into 
which both holistic and reductionistic explanations fit. 

Anteater: Absurd! Your "Mu" is as silly as a cow's moo. I'll have none of this Zen washy- 

Ant Fugue 


Crab: Ridiculous! Your "ML" is as silly as a kitten's mew. I'll have none of this Zen 

Achilles: Oh, dear! We're getting nowhere fast. Why have you stayed so strangely silent, 

Mr. Tortoise? It makes me very uneasy. Surely you must somehow be capable of 

helping straighten out this mess? 
Tortoise: I know the rest of you won't believe this, but the answer to the question is 

staring us all in the face, hidden in the picture. It is simply one word-but what an 

important one: "Mu"! 

Gust as he says this, the fourth voice in the fugue being played enters, exactly one octave 
below the first entry.) 

Achilles: Oh, Mr. T, for once you have let me down. I was sure that you, who always see 

the most deeply into things, would be able to resolve this dilemma-but apparently, 

you have seen no further than I myself saw. Oh, well, I guess I should feel pleased to 

have seen as far as Mr. Tortoise, for once. 
Tortoise: I beg your pardon, but my eyesight is extremely fine. Please look again, and 

then tell me if the picture doesn't say what I said it says. 
Achilles: But of course it does! You have merely repeated my own original observation. 
Tortoise: Perhaps "Mu" exists in this picture on a deeper level than you imagine, 

Achilles-an octave lower (figuratively speaking). But for now I doubt that we can 

settle the dispute in the abstract. I would like to see both the holistic and 

reductionistic points of view laid out more explicitly; then there may be more of a 

basis for a decision. I would very much like to hear a reductionistic description of an 

ant colony, for instance. 
Crab: Perhaps Dr. Anteater will tell you something of his experiences in that regard. 

After all, he is by profession something of an expert on that subject. 
Tortoise: I am sure that we have much to learn from you, Dr. Anteater. Could you tell us 

more about ant colonies, from a reductionistic point of view? 
Anteater: Gladly. As Mr. Crab mentioned to you, my profession has led me quite a long 

way into the understanding of ant colonies. 
Achilles: I can imagine! The profession of anteater would seem to be synonymous with 

being an expert on ant colonies! 
Anteater: I beg your pardon. "Anteater" is not my profession; it is my species. By 

profession, I am a colony surgeon. I specialize in correcting nervous disorders of the 

colony by the technique of surgical removal. 
Achilles: Oh, I see. But what do you mean by "nervous disorders" of an ant colony? 
Anteater: Most of my clients suffer from some sort of speech impairment. You know, 

colonies which have to grope for words in everyday situations. It can be quite tragic. 

I attempt to remedy the situation by, uhh — removing the defective part of the colony. 

These operations 

Ant Fugue 


are sometimes quite involved, and of course years of study are required before one 
can perform them. 

Achilles: But-isn't it true that, before one can suffer from speech impairment, one must 

have the faculty of speech? 
Anteater: Right. 

Achilles: Since ant colonies don't have that faculty, I am a little confused. Crab: It's too 

bad, Achilles, that you weren't here last week, when Dr. 
Anteater and Aunt Hillary were my house guests. I should have thought of having you 

over then. 

Achilles: Is Aunt Hillary your aunt, Mr. Crab? Crab: Oh, no, she's not really anybody's 

Anteater: But the poor dear insists that everybody should call her that, even strangers. It's 

just one of her many endearing quirks. 
Crab: Yes, Aunt Hillary is quite eccentric, but such a merry old soul. It's a shame I didn't 

have you over to meet her last week. 
Anteater: She's certainly one of the best-educated ant colonies I have ever had the good 

fortune to know. The two of us have spent many a long evening in conversation on 

the widest range of topics. 
Achilles: I thought anteaters were devourers of ants, not patrons of antintellectualism! 
Anteater: Well, of course the two are not mutually inconsistent. I am on the best of terms 

with ant colonies. It's just ANTS that I eat, not colonies-and that is good for both 

parties: me, and the colony. 
Achilles: How is it possible that— 
Tortoise: How is it possible that— 

Achilles: -having its ants eaten can do an ant colony any good? Crab: How is it possible 

Tortoise: -having a forest fire can do a forest any good? Anteater: How is it possible that 
Crab: -having its branches pruned can do a tree any good? Anteater: -having a haircut can 
do Achilles any good? 

Tortoise: Probably the rest of you were too engrossed in the discussion to notice the 

lovely stretto which just occurred in this Bach fugue. 
Achilles: What is a stretto? 

Tortoise: Oh, I'm sorry; I thought you knew the term. It is where one theme repeatedly 

enters in one voice after another, with very little delay between entries. 
Achilles: If I listen to enough fugues, soon I'll know all of these things and will be able to 

pick them out myself, without their having to be pointed out. 
Tortoise: Pardon me, my friends. I am sorry to have interrupted. Dr. Anteater was trying 

to explain how eating ants is perfectly consistent with being a friend of an ant colony. 
Achilles: Well, I can vaguely see how it might be possible for a limited and regulated 

amount of ant consumption to improve the overall health of 

Ant Fugue 


a colony-but what is far more perplexing is all this talk about having conversations 
with ant colonies. That's impossible. An ant colony is simply a bunch of individual 
ants running around at random looking for food and making a nest. 

Anteater: You could put it that way if you want to insist on seeing the trees but missing 
the forest, Achilles. In fact, ant colonies, seen as wholes, are quite well-defined units, 
with their own qualities, at times including the mastery of language. 

Achilles: I find it hard to imagine myself shouting something out loud in the middle of 
the forest, and hearing an ant colony answer back. 

Anteater: Silly fellow! That's not the way it happens. Ant colonies don't converse out 
loud, but in writing. You know how ants form trails leading them hither and thither? 

Achilles: Oh, yes-usually straight through the kitchen sink and into my peach jam. 

Anteater: Actually, some trails contain information in coded form. If you know the 
system, you can read what they're saying just like a book. Achilles: Remarkable. And 
can you communicate back to them? Anteater: Without any trouble at all. That's how 
Aunt Hillary and I have conversations for hours. I take a stick and draw trails in the 
moist ground, and watch the ants follow my trails. Presently, a new trail starts getting 
formed somewhere. I greatly enjoy watching trails develop. As they are forming, I 
anticipate how they will continue (and more often I am wrong than right). When the 
trail is completed, I know what Aunt Hillary is thinking, and I in turn make my reply. 

Achilles: There must be some amazingly smart ants in that colony, I'll say that. 

Anteater: I think you are still having some difficulty realizing the difference in levels 
here. Just as you would never confuse an individual tree with a forest, so here you 
must not take an ant for the colony. You see, all the ants in Aunt Hillary are as dumb 
as can be. They couldn't converse to save their little thoraxes! 

Achilles: Well then, where does the ability to converse come from? It must reside 
somewhere inside the colony! I don't understand how the ants can all be unintelligent, 
if Aunt Hillary can entertain you for hours with witty banter. 

Tortoise: It seems to me that the situation is not unlike the composition of a human brain 
out of neurons. Certainly no one would insist that individual brain cells have to be 
intelligent beings on their own, in order to explain the fact that a person can have an 
intelligent conversation. 

Achilles: Oh, no, clearly not. With brain cells, I see your point completely. Only ... ants 
are a horse of another color. I mean, ants just roam about at will, completely 
randomly, chancing now and then upon a morsel of food ... They are free to do what 
they want to do, and with that freedom, I don't see at all how their behaviour, seen as 
a whole, can 

Ant Fugue 


amount to anything coherent-especially something so coherent as the brain behavior 
necessary for conversing. 

Crab: It seems to me that the ants are free only within certain constraints. For example, 
they are free to wander, to brush against each other, to pick up small items, to work 
on trails, and so on. But they never step out of that small world, that ant-system, 
which they are in. It would never occur to them, for they don't have the mentality to 
imagine anything of the kind. Thus the ants are very reliable components, in the 
sense that you can depend on them to perform certain kinds of tasks in certain ways. 

Achilles: But even so, within those limits they are still free, and they just act at random, 
running about incoherently without any regard for the thought mechanisms of a 
higher-level being which Dr. Anteater asserts they are merely components of. 

Anteater: Ah, but you fail to recognize one thing. Achilles-the regularity of statistics. 

Achilles: How is that? 

Anteater: For example, even though ants as individuals wander about in what seems a 
random way, there are nevertheless overall trends, involving large numbers of ants, 
which can emerge from that chaos. 

Achilles: Oh, I know what you mean. In fact, ant trails are a perfect example of such a 
phenomenon. There, you have really quite unpredictable motion on the part of any 
single ant-and yet, the trail itself seems to remain well-defined and stable. Certainly 
that must mean that the individual ants are not just running about totally at random. 

Anteater: Exactly, Achilles. There is some degree of communication among the ants, just 
enough to keep them from wandering off completely at random. By this minimal 
communication they can remind each other that they are not alone but are 
cooperating with teammates. It takes a large number of ants, all reinforcing each 
other this way, to sustain any activity-such as trail-building-for any length of time. 
Now my very hazy understanding of the operation of brains leads me to believe that 
something similar pertains to the firing of neurons. Isn't it true, Mr. Crab, that it takes 
a group of neurons firing in order to make another neuron fire? 

Crab: Definitely. Take the neurons in Achilles' brain, for example. Each neuron receives 
signals from neurons attached to its input lines, and if the sum total of inputs at any 
moment exceeds a critical threshold, then that neuron will fire and send its own 
output pulse rushing off to other neurons, which may in turn fire-and on down the 
line it goes. The neural flash swoops relentlessly in its Achillean path, in shapes 
stranger then the dash of a gnat-hungry swallow; every twist, every turn foreordained 
by the neural structure in Achilles' brain, until sensory input messages interfere. 

Achilles: Normally, I think that I'M in control of what I think-but the way you put it turns 
it all inside out, so that it sounds as though "I" am just 

Ant Fugue 


what comes out of all this neural structure, and natural law. It makes what I consider 
my SELF sound at best like a by-product of an organism governed by natural law, 
and at worst, an artificial notion produced by my distorted perspective. In other 
words, you make me feel like I don't know who or what-I am, if anything. 

Tortoise: You'll come to understand much better as we go along. But Dr. 

Anteater-what do you make of this similarity? 

Anteater: I knew there was something parallel going on in the two very different systems. 
Now I understand it much better. It seems that group phenomena which have 
coherence-trail-building, for example-will take place only when a certain threshold 
number of ants get involved. If an effort is initiated, perhaps at random, by a few ants 
in some locale, one of two things can happen: either it will fizzle out after a brief 
sputtering start 

Achilles: When there aren't enough ants to keep the thing rolling? 

Anteater: Exactly. The other thing that can happen is that a critical mass of ants is 
present, and the thing will snowball, bringing more and more ants into the picture. In 
the latter case, a whole "team" is brought into being which works on a single project. 
That project might be trailmaking, or food-gathering, or it might involve nest- 
keeping. Despite the extreme simplicity of this scheme on a small scale, it can give 
rise to very complex consequences on a larger scale. 

Achilles: I can grasp the general idea of order emerging from chaos, as you sketch it, but 
that still is a long way from the ability to converse. After all, order also emerges from 
chaos when molecules of a gas bounce against each other randomly-yet all that 
results there is an amorphous mass with but three parameters to characterize it: 
volume, pressure, and temperature. Now that's a far cry from the ability to understand 
the world, or to talk about it! 

Anteater: That highlights a very interesting difference between the explanation of the 
behavior of an ant colony and the explanation of the behavior of gas inside a 
container. One can explain the behavior of the gas simply by calculating the 
statistical properties of the motions of its molecules. There is no need to discuss any 
higher elements of structure than molecules, except the full gas itself. On the other 
hand, in an ant colony, you can't even begin to understand the activities of the colony 
unless you go through several layers of structure. 

Achilles: I see what you mean. In a gas, one jump takes you from the lowest level- 
molecules-to the highest level-the full gas. There are no intermediate levels of 
organization. Now how do intermediate levels of organized activity arise in an ant 

Anteater: It has to do with the existence of several different varieties of ants inside any 

Achilles: Oh, yes. I think I have heard about that. They are called "castes", aren't they? 
Anteater: That's correct. Aside from the queen, there are males, who do 

Ant Fugue 


practically nothing towards, the upkeep of the nest, and then — 
Achilles: And of course there are soldiers-Glorious Fighters Against Communism! 
Crab: Hmm ... I hardly think that could be right, Achilles. An ant colony is quite 

communistic internally, so why would its soldiers fight against communism? Or am I 

right, Dr. Anteater? . 

Anteater: Yes, about colonies you are right, Mr. Crab; they are indeed based on 
somewhat communistic principles. But about soldiers Achilles is somewhat naive. In 
fact, the so-called "soldiers" are hardly adept at fighting at all. They are slow, 
ungainly ants with giant heads, who can snap with their strong jaws, but are hardly to 
be glorified. As in a true communistic state, it is rather the workers who are to be 
glorified. It is they who do most of the chores, such as food-gathering, hunting, and 
nursing of the young. It is even they who do most of the fighting. 

Achilles: Bah. That is an absurd state of affairs. Soldiers who won't fight! 

Anteater: Well, as I just said, they really aren't soldiers at all. It's the workers who are 
soldiers; the soldiers are just lazy fatheads. 

Achilles: Oh, how disgraceful! Why, if I were an ant, I'd put some discipline in their 
ranks! I'd knock some sense into those fatheads! 

Tortoise: If you were an ant? How could you be an ant? There is no way to map your 
brain onto an ant brain, so it seems to me to be a pretty fruitless question to worry 
over. More reasonable would be the proposition of mapping your brain onto an ant 
colony ... But let us not get sidetracked. Let Dr. Anteater continue with his most 
illuminating description of castes and their role in the higher levels of organization. 

Anteater: Very well. There are all sorts of tasks which must be accomplished in a colony, 
and individual ants develop specializations. Usually an ant's specialization changes as 
the ant ages. And of course it is also dependent on the ant's caste. At any one 
moment, in any small area of a colony, there are ants of all types present. Of course, 
one caste may be be very sparse in some places and very dense in others. 

Crab: Is the density of a given caste, or specialization, just a random thing? Or is there a 
reason why ants of one type might be more heavily concentrated in certain areas, and 
less heavily in others? 

Anteater: I'm glad you brought that up, since it is of crucial importance in understanding 
how a colony thinks. In fact, there evolves, over a long period of time, a very delicate 
distribution of castes inside a colony. And it is this distribution which allows the 
colony to have the complexity which underlies the ability to converse with me. 

Achilles: It would seem to me that the constant motion of ants to and fro would 
completely prevent the possibility of a very delicate distribution.Any delicate 
distribution would be quickly destroyed by all the random motions of ants, just as 
any delicate pattern among molecules in a gas would not survive for an instant, due 
to the random bombardment from all sides. 

Anteater: In an ant colony, the situation is quite the contrary. In fact, it is just exactly the 
to-ing and fro-ing of ants inside the colony 

Ant Fugue 


which adapts the caste distribution to varying situations, and thereby preserves the 
delicate caste distribution. You see, the caste distribution cannot remain as one single 
rigid pattern; rather, it must constantly be changing so as to reflect, in some manner, 
the real-world situation with which the colony is dealing, and it is precisely the 
motion inside the colony which updates the caste distribution, so as to keep it in line 
with the present circumstances facing the colony. 
Tortoise: Could you give an example? 

Anteater: Gladly. When I, an anteater, arrive to pay a visit to Aunt Hillary, all the foolish 
ants, upon sniffing my odor, go into a panic-which means, of course, that they begin 
running around completely differently from the way they were before I arrived. 

Achilles: But that's understandable, since you're a dreaded enemy of the colony. 

Anteater: Oh, no. I must reiterate that, far from being an enemy of the colony, I am Aunt 
Hillary's favorite companion. And Aunt Hillary is my favorite aunt. I grant you, I'm 
quite feared by all the individual ants in the colony-but that's another matter entirely. 
In any case, you see that the ants' action in response to my arrival completely changes 
the internal distribution of ants. 

Achilles: That's clear. 

Anteater: And that sort of thing is the updating which I spoke of. The new distribution 
reflects my presence. One can describe the change from old state to new as having 
added a "piece of knowledge" to the colony. 

Achilles: How can you refer to the distribution of different types of ants inside a colony 
as a "piece of knowledge"? 

Anteater: Now there's a vital point. It requires some elaboration. You see, what it comes 
down to is how you choose to describe the caste distribution. If you continue to think 
in terms of the lower levels-individual ants-then you miss the forest for the trees. 
That's just too microscopic a level, and when you think microscopically, you're 
bound to miss some large-scale features. You've got to find the proper high-level 
framework in which to describe the caste distribution-only then will it make sense 
how the caste distribution can encode many pieces of knowledge. 

Achilles: Well, how DO you find the proper-sized units in which to describe the present 
state of the colony, then? 

Anteater: All right. Let's begin at the bottom. When ants need to get something done, 
they form little "teams", which stick together to perform a chore. As I mentioned 
earlier, small groups of ants are constantly forming and unforming. Those which 
actually exist for a while are the teams, and the reason they don't fall apart is that 
there really is something for them to do. 

Achilles: Earlier you said that a group will stick together if its size exceeds a certain 
threshold. Now you're saying that a group will stick together if there is something for 
it to do. 

Anteater: They are equivalent statements. For instance, in food-gathering, 

Ant Fugue 


if there is an inconsequential amount of food somewhere which gets discovered by 
some wandering Ant who then attempts to communicate its enthusiasm to other ants, 
the number of ants who respond will be proportional to the size of the food sample- 
and an inconsequential amount will not attract enough ants to surpass the threshold. 
Which is exactly what I meant by saying there is nothing to do-too little food ought 
to be ignored. 

Achilles: I see. I assume that these "teams" are one of the levels of structure falling 
somewhere in between the single-ant level and the colony level. 

Anteater: Precisely. There exists a special kind of team, which I call a "signal"-and all the 
higher levels of structure are based on signals. In fact, all the higher entities are 
collections of signals acting in concert. There are teams on higher levels whose 
members are not ants, but teams on lower levels. Eventually you reach the lowest- 
level teams which is to say, signals-and below them, ants. 

Achilles: Why do signals deserve their suggestive name? 

Anteater: It comes from their function. The effect of signals is to transport ants of various 
specializations to appropriate parts of the colony. So the typical story of a signal is 
thus: it comes into existence by exceeding the threshold needed for survival, then it 
migrates for some distance through the colony, and at some point it more or less 
disintegrates into its individual members, leaving them on their own. 

Achilles: It sounds like a wave, carrying sand dollars and seaweed from afar, and leaving 
them strewn, high and dry, on the shore. 

4nteater: In a way that's analogous, since the team does indeed deposit something which 
it has carried from a distance, but whereas the water in the wave rolls back to the sea, 
there is no analogous carrier substance in the case of a signal, since the ants 
themselves compose it. 

Tortoise: And I suppose that a signal loses its coherency just at some spot in the colony 
where ants of that type were needed in the first place. 

Anteater: Naturally. 

Achilles: Naturally? It's not so obvious to ME that a signal should always go just where it 
is needed. And even if it goes in the right direction, how does it figure out where to 
decompose? How does it know it has arrived? 

Anteater: Those are extremely important matters, since they involve explaining the 
existence of purposeful behavior-or what seems to be purposeful behavior-on the part 
of signals. From the description, one would be inclined to characterize the signals' 
behavior as being oriented towards filling a need, and to call it "purposeful". But you 
can look at it otherwise. 

Achilles: Oh, wait. Either the behavior is purposeful, or it is NOT. I don't see how you 
can have it both ways. 

Anteater: Let me explain my way of seeing things, and then see if you agree. Once a 
signal is formed, there is no awareness on its part that it 

Ant Fugue 


should head off in any particular direction. But here, the delicate caste distribution 
plays a crucial role. It is what determines the motion of signals through the colony, 
and also how long a signal will remain stable, and where it will "dissolve". 
Achilles: So everything depends on the caste distribution, eh? 

Anteater: Right. Let's say a signal is moving along. As it goes, the ants which compose it 
interact, either by direct contact or by exchange of scents, with ants of the local 
neighborhoods which it passes through. The contacts and scents provide information 
about local matters of urgency, such as nest-building, or nursing, or whatever. The 
signal will remain glued together as long as the local needs are different from what it 
can supply; but if it CAN contribute, it disintegrates, spilling a fresh team of usable 
ants onto the scene. Do you see now how the caste distribution acts as an overall 
guide of the teams inside the colony? 

Achilles: I do see that. 

Anteater: And do you see how this way of looking at things requires attributing no sense 
of purpose to the signal? 

Achilles: I think so. Actually, I'm beginning to see things from two different vantage 
points. From an ant's-eye point of view, a signal has NO purpose. The typical ant in a 
signal is just meandering around the colony, in search of nothing in particular, until it 
finds that it feels like stopping. Its teammates usually agree, and at that moment the 
team unloads itself by crumbling apart, leaving just its members but none of its 
coherency. No planning is required, no looking ahead; nor is any search required, to 
determine the proper direction. But from the COLONY'S point-of view, the team has 
just responded to a message which was written in the language of the caste 
distribution. Now from this perspective, it looks very much like purposeful activity. 

Crab: What would happen if the caste distribution were entirely random? Would signals 
still band and disband? 

Anteater: Certainly. But the colony would not last long, due to the meaninglessness of the 
caste distribution. 

Crab: -Precisely the point I wanted to make. Colonies survive because their caste 
distribution has meaning, and that meaning is a holistic aspect, invisible on lower 
levels. You lose explanatory power unless you take that higher level into account. 

Anteater: I see your side; but I believe you see things too narrowly. 

Crab: How so? 

Anteater: Ant colonies have been subjected to the rigors of evolution for billions of years. 
A few mechanisms were selected for, and most were selected against. The end result 
was a set of mechanisms which make ant colonies work as we have been describing. 
If you could watch the whole process in a movie-running a billion or so times faster 
than life, of course-the emergence of various mechanisms would be seen as natural 
responses to external pressures, just as bubbles in boiling water are natural responses 
to an external heat source. I don't suppose you 

Ant Fugue 


see "meaning" and "purpose", in the bubbles in boiling water-or do you? 
Crab: No, but 

Anteater: Now that's MY point. No matter how big a bubble is, it owes its existence to 
processes on the molecular level, and you can forget about any "higher-level laws". 
The same goes for ant colonies and their teams. By looking at things from the vast 
perspective of evolution, you can drain the whole colony of meaning and purpose. 
They become superfluous notions. 

Achilles: Why, then, Dr. Anteater, did you tell me that you talked with Aunt Hillary? It 
now seems that you would deny that she can talk or think at all. 

Anteater: I am not being inconsistent, Achilles. You see, I have as much difficulty as 
anyone else in seeing things on such a grandiose time scale, so I find it much easier 
to change points of view. When I do so, forgetting about evolution and seeing things 
in the here and now, the vocabulary of teleology comes back: the MEANING of the 
caste distribution and the PURPOSEFULNESS of signals. This not only happens 
when I think of ant colonies, but also when I think about my own brain and other 
brains. However, with some effort I can always remember the other point of view if 
necessary, and drain all these systems of meaning, too. 

Crab: Evolution certainly works some miracles. You never know the next trick it will pull 
out of its sleeve. For instance, it wouldn't surprise me one bit if it were theoretically 
possible for two or more "signals" to pass through each other, each one unaware that 
the other one is also a signal; each one treating the other as if it were just part of the 
background population. 

Anteater: It is better than theoretically possible; in fact it happens routinely! 

Achilles: Hmm ... What a strange image that conjures up in my mind. I can just imagine 
ants moving in four different directions, some black, some white, criss-crossing, 
together forming an orderly pattern, almost like-like 

Tortoise: A fugue, perhaps? 

Achilles: Yes-that's it! An ant fugue! 

Crab: An interesting image, Achilles. By the way, all that talk of boiling water made me 
think of tea. Who would like some more? Achilles: I could do with another cup, Mr. 

Crab: Very good. 

Achilles: Do you suppose one could separate out the different visual "voices" of such an 

"ant fugue"? I know how hard it is for me 
Tortoise: Not for me, thank you. 
Achilles: -to track a single voice 
Anteater: I'd like some, too, Mr. Crab 
Achilles: — in a musical fugue- 

Ant Fugue 


FIGURE 61. "Ant Fugue", by M. C. Escher (woodcut, 1953). 

Anteater: -if it isn't too much trouble 
Achilles: . -when all of them 
Crab: Not at all. Four cups of tea 
Tortoise: Three? 
Achilles: -are going at once. 
Crab: -coming right up! 

Anteater: That's an interesting thought, Achilles. But its unlikely that anyone could draw 

such a picture in a convincing way 
Achilles: That's too bad. 

Tortoise: Perhaps you could answer this, Dr. Anteater. Does a signal, from its creation 

until its dissolution, always consist of the same set of ants? 
Anteater: As a matter of fact, the individuals in a signal sometimes break off and get 

replaced by others of the same caste, if there are a few in the area. Most often, signals 

arrive at their disintegration points with nary an ant in common with their starting 


Ant Fugue 


Crab: I can see that the signals are constantly affecting the caste distribution throughout 
the colony, and are doing so in response to the internal needs of the colony-which in 
turn reflect the external situation which the colony is faced with. Therefore the caste 
distribution, as you said, Dr. Anteater, gets continually updated in a way which 
ultimately reflects the outer world. 

Achilles: But what about those intermediate levels of structure? You were saying that the 
caste distribution should best be pictured not in terms of ants or signals, but in terms 
of teams whose members were other teams, whose members were other teams, and 
so on until you come down to the ant level. And you said that that was the key to 
understanding how it was possible to describe the caste distribution as encoding 
pieces of information about the world. 

Anteater: Yes, we are coming to all that. I prefer to give teams of a sufficiently high level 
the name of "symbols". Mind you, this sense of the word has some significant 
differences from the usual sense. My "symbols" are ACTIVE SUBSYSTEMS of a 
complex system, and they are composed of lower-level active subsystems ... They are 
therefore quite different from PASSIVE symbols, external to the system, such as 
letters of the alphabet or musical notes, which sit there immobile, waiting for an 
active system to process them. 

Achilles: Oh, this is rather complicated, isn't it? I just had no idea that ant colonies had 
such an abstract structure. 

Anteater: Yes, it's quite remarkable. But all these layers of structure are necessary for the 
storage of the kinds of knowledge which enable an organism to be "intelligent" in 
any reasonable sense of the word. Any system which has a mastery of language has 
essentially the same underlying sets of levels. 

Achilles: Now just a cotton-picking minute. Are you insinuating that my brain consists 
of, at bottom, just a bunch of ants running around? 

Anteater: Oh, hardly. You took me a little too literally. The lowest level may be utterly 
different. Indeed, the brains of anteaters, for instance, are not composed of ants. But 
when you go up a level or two in a brain, you reach a level whose elements have 
exact counterparts in other systems of equal intellectual strength-such as ant colonies. 

Tortoise: That is why it would be reasonable to think of mapping your brain, Achilles, 
onto an ant colony, but not onto the brain of a mere ant. 

Achilles: I appreciate the compliment. But how would such a mapping be carried out? 
For instance, what in my brain corresponds to the low level teams which you call 

Anteater: Oh, I but dabble in brains, and therefore couldn't set up the map in its glorious 
detail. But-and correct me if I'm wrong, Mr. Crab-I would surmise that the brain 
counterpart to an ant colony's signal is the firing of a neuron; or perhaps it is a larger- 
scale event, such as a pattern of neural firings. 

Ant Fugue 


Crab: I would tend to agree. But don't you think that, for the purposes of our discussion, 
delineating the exact counterpart is not in itself crucial, desirable though it might be? 
It seems to me that the main idea is that such a correspondence does exist, even if we 
don't know exactly how to define it right now. I would only question one point, Dr. 
Anteater, which you raised, and that concerns the level at which one can have faith 
that the correspondence begins. You seemed to think that a SIGNAL might have a 
direct counterpart in a brain; whereas I feel that it is only at the level of your 
ACTIVE SYMBOLS and above that it is likely that a correspondence must exist. 

Anteater: Your interpretation may very well be more accurate than mine, Mr. Crab. 
Thank you for bringing out that subtle point. 

Achilles: What does a symbol do that a signal couldn't do? 

Anteater: It is something like the difference between words and letters. Words, which are 
meaning-carrying entities, are composed of letters, which in themselves carry no 
meaning. This gives a good idea of the difference between symbols and signals. In 
fact it is a useful analogy, as long as you keep in mind the fact that words and letters 
are PASSIVE, symbols and signals are ACTIVE. 

Achilles: I'll do so, but I'm not sure I understand why it is so vital to stress the difference 
between active and passive entities. 

Anteater: The reason is that the meaning which you attribute to any passive symbol, such 
as a word on a page, actually derives from the meaning which is carried by 
corresponding active symbols in your brain. So that the meaning of passive symbols 
can only be properly understood when it is related to the meaning of active symbols. 

Achilles: All right. But what is it that endows a SYMBOL-an active one, to be sure- with 
meaning, when you say that a SIGNAL, which is a perfectly good entity in its own 
right, has none? Anteater: It all has to do with the way that symbols can cause other 
symbols to be triggered. When one symbol becomes active, it does not do so in 
isolation. It is floating about, indeed, in a medium, which is characterized by its caste 

Crab: Of course, in a brain there is no such thing as a caste distribution, but the 
counterpart is the "brain state". There, you describe the states of all the neurons, and 
all the interconnections, and the threshold for firing of each neuron. 

Anteater: Very well; let's lump "caste distribution" and "brain state" under a common 
heading, and call them just the "state". Now the state can be described on a low level 
or on a high level. A low-level description of the state of an ant colony would involve 
painfully specifying the location of each ant, its age and caste, and other similar 
items. A very detailed description, yielding practically no global insight as to WHY it 
is in that state. On the other hand, a description on a high level would involve 
specifying which symbols could be triggered by which combinations of other 
symbols, under what conditions, and so forth. 

Ant Fugue 


Achilles: What about a description on the level of signals, or teams? 

Anteater: A description on that level would fall somewhere in between the low-level and 
symbol-level descriptions. It would contain a great deal of information about what is 
actually going on in specific locations throughout the colony, although certainly less 
than an ant-by-ant description, since teams consist of clumps of ants. A team-by-team 
description is like a summary of an ant-by-ant description. However, you have to add 
extra things which were not present in the ant-by-ant description-such as the 
relationships between teams, and the supply of various castes here and there. This 
extra complication is the price you pay for the right to summarize. 

Achilles: It is interesting to me to compare the merits of the descriptions at various levels. 
The highest-level description seems to carry the most explanatory power, in that it 
gives you the most intuitive picture of the ant colony, although strangely enough, it 
leaves out seemingly- the most important feature -the ants. 

Anteater: But you see, despite appearances, the ants are not the most important feature. 
Admittedly, were it not for them, the colony Wouldn't exist: but something 
equivalent-a brain-can exist, ant-free. So, at least from a high-level point of view, the 
ants are dispensable. Achilles: I'm sure no ant would embrace your theory with 

Anteater: Well, I never met an ant with a high-level point of view. 

Crab: What a counterintuitive picture you paint, Dr. Anteater. It seems that, if what you 
say is true, in order to grasp the whole structure, you have to describe it omitting any 
mention of its fundamental building blocks. 

Anteater: Perhaps I can make it a little clearer by an analogy. Imagine you have before 
you a Charles Dickens novel. 

Achilles: The Pickwick Papers- will that do? 

Anteater: Excellently! And now imagine trying the following game: you must find a way 
of mapping letters onto ideas, so that the entire Pickwick Papers makes sense when 
you read it letter by letter. 

Achilles: Hmm ... You mean that every time I hit a word such as "the", I have to think of 
three definite concepts, one after another, with no room for variation? 

Anteater: Exactly. They are the Y-concept, the 'h'-concept, and the V-concept-and every 
time, those concepts are as they were the preceding time. 

Achilles: Well, it sounds like that would turn the experience of "reading" The Pickwick 
Papers into an indescribably boring nightmare. It would be an exercise in 
meaninglessness, no matter what concept I associated with each letter. 

Anteater: Exactly. There is no natural mapping from the individual letters into the real 
world. The natural mapping occurs on a higher level between words, and parts of the 
real world. If you wanted to describe the book, therefore, you would make no 
mention of the letter level. 

Ant Fugue 


Achilles: Of course not! I'd describe the plot and the characters, and so forth. 

Anteater: So there you are. You would omit all mention of the building blocks, even 

though the book exists thanks to them. They are the medium, but not the message. 
Achilles: All right-but what about ant colonies? 

Anteater: Here, there are active signals instead of passive letters, and active symbols 

instead of passive words-hut the idea carries over. 
Achilles: Do you mean I couldn't establish a mapping between signals and things in the 

real world? 

Anteater: You would find that you could not do it in such a way that the triggering of new 
signals would make am sense. Nor could you succeed on any lower level-for example 
the ant level. Only on the symbol level do the triggering patterns make sense. 
Imagine, for instance, that one day you were watching Aunt Hillary when I arrived to 
pay a call. You could watch as carefully as you wanted, and yet you would probably 
perceive nothing more than a rearrangement of ants. 

Achilles: I'm sure that's accurate. 

Anteater: And yet, as I watched, reading the higher level instead of the lower level, I 
would see several dormant symbols being awakened, those which translate into the 
thought, "Oh, here's that charming Dr. Anteater again-how pleasant! "-or words to 
that effect. 

Achilles: That sounds like what happened when the four of us all found different levels to 

read in the MU-picture— or at least THREE of us did .. . 
Tortoise: What an astonishing coincidence that there should be such a resemblance 

between that strange picture which I chanced upon in the Well-Tempered Clavier, 

and the trend of our conversation. 
Achilles: Do you think it's just coincidence? 
Tortoise: Of course. 

Anteater: Well, I hope you can grasp now how the thoughts in Aunt Hillary emerge from 
the manipulation of symbols composed of signals composed of teams composed of 
lower-level teams, all the way down to ants. 

Achilles: Why do you call it "symbol manipulation"? Who does the manipulating, if the 
symbols are themselves active? Who is the agent? 

Anteater: This gets back to the question which you earlier raised about purpose. You're 
right that symbols themselves are active, but the activities which they follow are 
nevertheless not absolutely free. The activities of all symbols are strictly determined 
by the state of the full system in which they reside. Therefore, the full system is 
responsible for how its symbols trigger each other, and so it is quite reasonable to 
speak of the full system as the "agent". As the symbols operate, the state of the 
system gets slowly transformed, or updated. But there are many features which 
remain over time. It is this partially constant, partially varying system which is the 
agent. One can give a name to the 

Ant Fugue 


full system. For example, Aunt Hillary is the "who" who can be said to manipulate 

her symbols; and you are similar, Achilles. 
Achilles: That's quite a strange characterization of the notion of who I am. I'm not sure I 

can fully understand it, but I will give it some thought. 
Tortoise: It would be quite interesting to follow the symbols in your brain as you do that 

thinking about the symbols in your brain. 
Achilles: That's too complicated for me. I have trouble enough just trying to picture how 

it is possible to look at an ant colony and read it on the symbol level. I can certainly 

imagine perceiving it at the ant level; and with a little trouble, I can imagine what it 

must be like to perceive it at the signal level; but what in the world can it be like to 

perceive an ant colony at the symbol level? 
Anteater: One only learns through long practice. But when one is at my stage, one reads 

the top level of an ant colony as easily as you yourself read the "MU" in the MU- 


Achilles: Really? That must be an amazing experience. 

Anteater: In a way-but it is also one which is quite familiar to you, Achilles. 

Achilles: Familiar to me? What do you mean? I have never looked at an ant colony on 

anything but the ant level. 
Anteater: Maybe not; but ant colonies are no different from brains in many respects. 
Achilles: I have never seen nor read any brain either, however. 

Anteater: What about your OWN brain? Aren't you aware of your own thoughts? Isn't 

that the essence of consciousness? What else are you doing but reading your own 

brain directly at the symbol level? 
Achilles: I never thought of it that way. You mean that I bypass all the lower levels, and 

only see the topmost level? 
Anteater: That's the way it is, with conscious systems. They perceive themselves on the 

symbol level only, and have no awareness of the lower levels, such as the signal 


Achilles: Does it follow that in a brain, there are active symbols which are constantly 
updating themselves so that they reflect the overall state of the brain itself, always on 
the symbol level? 

Anteater: Certainly. In any conscious system there are symbols which represent the brain 
state, and they are themselves part of the very brain state which they symbolize. For 
consciousness requires a large degree of self-consciousness. 

Achilles: That is a weird notion. It means that although there is frantic activity occurring 
in my brain at all times, I am only capable of registering that activity in one way-on 
the symbol level; and I am completely insensitive to the lower levels. It is like being 
able to read a Dickens novel by direct visual perception, without ever having learned 
the letters of the alphabet. I can't imagine anything as weird as that really happening. 

Crab: But precisely that sort of thing can happen when you read "MU", 

Ant Fugue 


without perceiving the lower levels "HOLISM" and "REDUCTIONISM". 

Achilles: You're right-I bypassed the lower levels, and saw only the top. I wonder if I'm 
missing all sorts of meaning on lower levels of my brain as well, by reading only the 
symbol level. It's too bad that the top level doesn't contain all the information about 
the bottom level, so that by reading the top, one also learns what the bottom level 
says. But I guess it would be naive to hope that the top level encodes anything from 
the bottom level-it probably doesn't percolate up. The MU-picture is the most striking 
possible example of that: there, the topmost level says only "ML which bears no 
relation whatever to the lower levels! 

Crab: That's absolutely true. {Picks up the MU-picture, to inspect it more closely) Hmm 
... There's something strange about the smallest letters in this picture; they're very 
wiggly ... ' 

Anteater: Let me take a look. (Peers closely at the MU-picture.) I think there's yet 

another level, which all of us missed! 
Tortoise: Speak for yourself, Dr. Anteater. 

Achilles: Oh, no-that can't be! Let me see. {Looks very carefully.) I know the rest of you 
won't believe this, but the message of this picture is staring us all in the face, hidden 
in its depths. It is simply one word, repeated over and over again, like a mantra-but 
what an important one: "Mu"! What do you know! It is the same as the top level! 
And none of us suspected it in the least. 

Crab: We would never have noticed it if it hadn't been for you, Achilles. Anteater: I 
wonder if the coincidence of the highest and lowest levels happened by chance? Or 
was it a purposeful act carried out by some creator? 

Crab: How could one ever decide that? 

Tortoise: I don't see any way to do so, since we have no idea why that particular picture is 
in the Crab's edition of the Well-Tempered Clavier. Anteater: Although we have been 
having a lively discussion, I have still managed to listen with a good fraction of an 
ear to this very long and complex four-voice fugue. It is extraordinarily beautiful. 

Tortoise: It certainly is. And now, in just a moment, comes an organ point. 

Achilles: Isn't an organ point what happens when a piece of music slows down slightly, 
settles for a moment or two on a single note or chord, and then resumes at normal 
speed after a short silence? 

Tortoise: No, you're thinking of a "fermata"-a sort of musical semicolon. Did you notice 
there was one of those in the prelude? 

Achilles: I guess I must have missed it. 

Tortoise: Well, you have another chance coming up to hear a fermata-in fact, there are a 

couple of them coming up, towards the end of this fugue. 
Achilles: Oh, good. You'll point them out in advance, won't you? Tortoise: If you like. 
Achilles: But do tell me, what is an organ point? 
Tortoise: An organ point is the sustaining of a single note by one of the 

Ant Fugue 


voices in a polyphonic piece (often the lowest voice), while the other voices continue 
their own independent lines, This organ point is on the note of G. Listen carefully, 
and you'll hear it. 

Anteater:. There occurred an incident one day when I visited with Aunt Hillary which 
reminds me of your suggestion of observing the symbols in Achilles' brain as they 
create thoughts which are about themselves. 

Crab: Do tell us about it. 

Anteater: Aunt Hillary had been feeling very lonely, and was very happy to have 
someone to talk to that day. So she gratefully told me to help myself to the juiciest 
ants I could find. (She's always been most generous with her ants.) 

Achilles: Gee! 

Anteater: It just happened that I had been watching the symbols which were carrying out 

her thoughts, because in them were some particularly juicy-looking ants. 
Achilles: Gee! 

Anteater: So I helped myself to a few of the fattest ants which had been parts of the 
higher-level symbols which I had been reading. Specifically, the symbols which they 
were part of were the ones which had expressed the thought, "Help yourself to any of 
the ants which look appetizing." 

Achilles: Gee! 

Anteater: Unfortunately for them, but fortunately for me, the little bugs didn't have the 
slightest inkling of what they were collectively telling me, on the symbol level. 

Achilles: Gee! That is an amazing wraparound. They were completely unconscious of 
what they were participating in. Their acts could be seen as part of a pattern on a 
higher level, but of course they were completely unaware of that. Ah, what a pity-a 
supreme irony, in fact-that they missed it. 

Crab: You are right, Mr. T-that was a lovely organ point. 

Anteater: I had never heard one before, but that one was so conspicuous that no one could 

miss it. Very effective. 
Achilles: What? Has the organ point already occurred? How can I not have noticed it, if it 

was so blatant? 

Tortoise: Perhaps you were so wrapped up in what you were saying that you were 
completely unaware of it. Ah, what a pity-a supreme irony, in fact-that you missed it. 
Crab: Tell me, does Aunt Hillary live in an anthill? 

Anteater: Well, she owns a rather large piece of property. It used to belong to someone 

else, but that is rather a sad story. In any case, her estate is quite expansive. She lives 

rather sumptuously, compared to many other colonies. 
!chilies: How does that jibe with the communistic nature of ant colonies which you 

earlier described to us? It sounds quite inconsistent, to me, to preach communism and 

to live in a fancy estate. 

Ant Fugue 


Anteater: The communism is on the ant level. In an ant colony all ants work for the 
common good, even to their own individual detriment at times. Now this is simply a 
built-in aspect of Aunt Hillary's structure, but for all I know, she may not even be 
aware of this internal communism. Most human beings are not aware of anything 
about their neurons; in fact they probably are quite content not to know anything 
about their brains, being somewhat squeamish creatures. Aunt Hillary is also 
somewhat squeamish; she gets rather antsy whenever she starts to think about ants at 
all. So she avoids thinking about them whenever possible. I truly doubt that she 
knows anything about the communistic society which is built into her very structure. 
She herself is a staunch believer in libertarianism-you know, laissez-faire and all that. 
So it makes perfect sense, to me at least, that she should live in a rather sumptuous 

Tortoise: As I turned the page just now, while following along in this lovely edition of 
the Well-Tempered Clavier, I noticed that the first of the two fermatas is coming up 
soon-so you might listen for it, Achilles. Achilles: I will, I will. 

Tortoise: Also, there's a most curious picture facing this page. Crab: Another one? What 

Tortoise: See for yourself. (Passes the score over to the Crab.) 

Crab: Aha! It's just a few bunches of letters. Let's see-there are various numbers of the 
letters T, 'S', 'B', 'm', 'a', and 't'. It's strange, how the first three letters grow, and then 
the last three letters shrink again. Anteater: May I see it? 

Crab: Why, certainly. 

Anteater: Oh, by concentrating on details, you have utterly missed the big picture. In 
reality, this group of letters is T , V, Y, A', C, 'H, without any repetitions. First 
they get smaller, then they get bigger. Here, Achilles- what do you make of it? 

Achilles: Let me see. Hmm. Well, I see it as a set of upper-case letters which grow as you 
move to the right. 

Tortoise: Do they spell anything? 

Ant Fugue 


Achilles: Ah ... "J. S. BACH". Oh! I understand now. It's Bach's name! 

Tortoise: Strange that you should see it that way. I see it as a set of lower-case letters, 

shrinking as they move to the right, and ... spelling out ... the name of... (Slows down 

slightly, especialh drawing out the last few words. Then there is a brief silence. 

Suddenly he resumes as if nothing unusual had happened.) -"fermat". 
Achilles: Oh, you've got Fermat on the brain, I do believe. You see Fermat's Last 

Theorem everywhere. 

Anteater: You were right, Mr. Tortoise-I just heard a charming little fermata in the fugue. 
Crab: So did I. 

Achilles: Do you mean everybody heard it but me? I'm beginning to feel stupid. 
Tortoise: There, there, Achilles-don't feel bad. I'm sure you won't miss Fugue's Last 

Fermata (which is coming up quite soon). But, to return to our previous topic, Dr. 

Anteater, what is the very sad story which you alluded to, concerning the former 

owner of Aunt Hillary's property 
Anteater: The former owner was an extraordinary individual, one of the most creative ant 

colonies who ever lived. His name was Johant Sebastiant Fermant, and he was a 

mathematiciant by vocation, but a musiciant by avocation. 
Achilles: How very versantile of him! 

Anteater: At the height of his creative powers, he met with a most untimely demise. One 
day, a very hot summer day, he was out soaking up the warmth, when a freak 
thundershower-the kind that hits only once every hundred years or so-appeared from 
out of the blue, and thoroughly drenched J. S F. Since the storm came utterly without 
warning, the ants got completely disoriented and confused. The intricate organization 
which had been so finely built up over decades, all went down the drain in a matter of 
minutes. It was tragic. 

Achilles: Do you mean that all the ants drowned, which obviously would spell the end of 
poor J. S. F. 

Anteater: Actually, no. The ants managed to survive, every last one of them, by crawling 
onto various sticks and logs which floated above the raging torrents. But when the 
waters receded and left the ants back on their home grounds, there was no 
organization left. The caste distribution was utterly destroyed, and the ants 
themselves had no ability to reconstruct what had once before been such a finely 
tuned organization. They were as helpless as the pieces of Humpty Dumpty in putting 
themselves back together again. I myself tried, like all the king's horses and all the 
king's men, to put poor Fermant together again. I faithfully put out sugar and cheese, 
hoping against hope that somehow Fermant would reappear ... (Pulls out a 
handkerchief and wipes his eyes.) 

Achilles: How valiant of you! I never knew Anteaters had such big hearts. 

Anteater: But it was all to no avail. He was Bone, beyond reconstitution. 

Ant Fugue 


However, something very strange then began to take place: over the next few 

months, the ants which had been components of J. S. F. slowly regrouped, and built 

up a new organization. And thus was Aunt Hillary born. 
Crab: Remarkable! Aunt Hillary is composed of the very same ants as Fermant was 
Anteater: Well, originally she was, yes. By now, some of the older ants have died, and 

been replaced. But there are still many holdovers from the J. S. F.-days. 
Crab: And can't you recognize some of J. S. F.'s old traits coming to the fore, from time 

to time, in Aunt Hillary% 
Anteater: Not a one. They have nothing in common. And there is no reason they should, 

as I see it. There are, after all, often several distinct ways to rearrange a group of 

parts to form a "sum". And Aunt Hillary was just a new "sum" of the old parts. Not 

MORE than the sum, mind you just that particular KIND of sum. 
Tortoise: Speaking of sums, I am reminded of number theory, where occasionally one 

will be able to take apart a theorem into its component symbols, rearrange them in a 

new order, and come up with a new theorem. 
Anteater: I've never heard of such a phenomenon, although I confess to being a total 

ignoramus in the field. 

Achilles: Nor have I heard of it-and I am rather well versed in the field, If I don't say so 
myself. I suspect Mr. T is just setting up one of his elaborate spoofs. I know him 
pretty well by now. Anteater: Speaking of number theory, I am reminded of J. S. F. 
again, for number theory is one of the domains in which he excelled. In fact, he made 
some rather rema, contributions to number theory. Aunt Hillary, on the other 
hand, is remarkably dull-witted in anything that has even the remotest connection 
with mathematics. Also, she has only a rather banal taste in music, whereas 
Sebastiant was extremely gifted in music. 

Achilles: I am very fond of number theory. Could you possibly relate to us something of 
the nature of Sebastiant's contributions, 

Anteater: Very well, then. (Pauses for a moment to sip his tea, then resumes.) 
Have you heard of Fourmi's infamous "Well-Tested Conjecture"? 

Achilles. I'm not sure ... It sounds strangely familiar, and yet I can't quite place it. 

Anteater: It's a very simple idea. Lierre de Fourmi, a mathematiciant by vocation but 
lawyer by avocation, had been reading in his copy-of the classic text Arithmetica by 
Di of Antus, and came across a page containing the equation 

2 a +2 b =2 c 

He immediately realized that this equation has infinitely many solutions a. b, c, and 
then wrote in the margin the following notorious comment: 

Ant Fugue 


FIGURE 63. During emigrations arm' ants sometimes create living bridges of their 
own bodies. In this photograph of such a bridge (de Fourmi Lierre), the workers of 
an Eciton burchelli colony can be seen linking their legs and, along the top of the 
bridge, hooking their tarsal claws together to form irregular systems of chains. .A 
symbiotic silverfish, Trichatelura manni, is seen crossing the bridge in the center. 
[From E. O. Wilson, The Insect Societies 'Cambridge, Mass.: Harvard University 
Press, 1971), p. 62) 

The equation 

n a +n b =n c 

has solutions in positive integers a, b, c, and n only when n = 2 (and then there are 
infinitely many triplets a, b, c which satisfy the equation); but there are no solutions 
for n > 2. I have discovered a truly marvelous proof of this statement, which, 
unfortunately, is so small that it would be well-nigh invisible if written in the margin. 
Ever since that year, some three hundred days ago, mathematiciants have been vainly 
trying to do one of two things: either to prove Fourmi's claim, and thereby vindicate 
Fourmi's reputation, which, although very high, has been somewhat tarnished by 
skeptics who think he never really found the proof he claimed to have found-or else 
to refute the claim, by finding a counterexample: a set of four integers a, b, c, and n, 
with n > 2, which satisfy the equation. Until very recently, every attempt in either 
direction had met with failure. To be sure, the Conjecture has been verified for many 
specific values of n-in particular, all n up to 125,000. But no one had succeeded in 
proving it for ALL n-no one, that is, until Johant Sebastiant Fermant came upon the 
scene. It was he who found the proof that cleared Fourmi's name. 

Ant Fugue 


It now goes under the name "Johant Sebastiant's Well-Tested Conjecture". 
Achilles: Shouldn't it be called a "Theorem" rather than a "Conjecture", if it's finally been 

given a proper proof; 
Anteater: Strictly speaking, you're right, but tradition has kept it this way. 
Tortoise: What sort of music did Sebastiant do? 

Anteater: He had great gifts for composition. Unfortunately, his greatest work is shrouded 
in mystery, for he never reached the point of publishing it. Some believe that he had 
it all in his mind; others are more unkind, saying that he probably never worked it out 
at all, but merely blustered about it. 

Achilles: What was the nature of this magnum opus? 

Anteater: It was to be a giant prelude and fugue; the fugue was to have 
twenty-four voices, and to involve twenty-four distinct subjects, one in 
each of the major and minor keys. 

Achilles: It would certainly be hard to listen to a twenty-four-voice fugue 
as a whole! 

Crab: Not to mention composing one! 
Anteater: But all that we know of it is Sebastiant's description of it, which he wrote in the 

margin of his copy of Buxtehude's Preludes and Fugues for Organ. The last words which 

he wrote before his tragic demise were: 

I have composed a truly marvelous fugue. In it, I have added 
together the power of 24 keys, and the power of 24 themes; I 
came up with a fugue with the power of 24 voices. Unfortunately, 
this margin is too narrow to contain it. 

And the unrealized masterpiece simply goes by the name, "Fermant's Last Fugue". 
Achilles: Oh, that is unbearably tragic. 

Tortoise: Speaking of fugues, this fugue which we have been listening to is nearly over. 
Towards the end, there occurs a strange new twist on its theme. (Flips the page in the 
Well-Tempered Clavier.) Well, what have we here? A new illustration-how 
appealing! (Shows it to the Crab.) 






FIGURE 64. [Drawing by the author.] 

7M 1 o°o W \ 

1 \. L 






\ £ ■ 

V I 


Ant Fugue 


Crab: Well, what have we here? Oh, I see: It's HOLISMIONSIM", written in large letters 

that first shrink and then grow back to their original size. But that doesn't make any 

sense, because it's not a word. Oh me, oh my! (Passes it to the Anteater.) 
Anteater: Well, what have we here? Oh, I see: it's "REDUCTHOLISM", written in small 

letters that first grow and then shrink back to their original size. But that doesn't make 

any sense, because it's not a word. Oh my, oh me! (Passes it to Achilles.) 
Achilles: I know the rest of you won't believe this, but in fact this picture consists of the 

word "HOLISM" written twice, with the letters continually shrinking as they proceed 

from left to right. (Returns it to the Tortoise.) 
Tortoise: I know the rest of you won't believe this, but in fact this picture consists of the 

word "REDUCTIONISM" written once, with the letters continually growing as they 

proceed from left to right. 
Achilles: At last-I heard the new twist on the theme this time! I am so glad that you 

pointed it out to me, Mr. Tortoise. Finally, I think I am beginning to grasp the art of 

listening to fugues. 

Ant Fugue 


Brains and Thoughts 

New Perspectives on Thought 

IT WAS ONLY with the advent of computers that people actually tried to create 
"thinking" machines, and witnessed bizarre variations on the theme, of thought. Programs 
were devised whose "thinking" was to human thinking as a slinky flipping end over end 
down a staircase is to human locomotion. All of a sudden the idiosyncrasies, the 
weaknesses and powers, the vagaries and vicissitudes of human thought were hinted at by 
the newfound ability to experiment with alien, yet hand-tailored forms of thought-or 
approximations of thought. As a result, we have acquired, in the last twenty years or so, a 
new kind of perspective on what thought is, and what it is not. Meanwhile, brain 
researchers have found out much about the small-scale and large-scale hardware of the 
brain. This approach has not yet been able to shed much light on how the brain 
manipulates concepts, but it gives us some ideas about the biological mechanisms on 
which thought manipulation rests. 

In the coming two Chapters, then, we will try to unite some insights gleaned from 
attempts at computer intelligence with some of the facts learned from ingenious 
experiments on living animal brains, as well as with results from research on human 
thought processes done by cognitive psychologists. The stage has been set by the 
Prelude, Ant Fugue; now we develop the ideas more deeply. 

Intensionality and Extensionality 

Thought must depend on representing reality in the hardware of the brain. In the 
preceding Chapters, we have developed formal systems which represent domains of 
mathematical reality in their symbolisms. To what extent is it reasonable to use such 
formal systems as models for how the brain might manipulate ideas? 
We saw, in the pq-system and then in other more complicated systems, how meaning, in 
a limited sense of the term, arose as a result of an isomorphism which maps typographical 
symbols onto numbers, operations, and relations; and strings of typographical symbols 
onto statements. Now in the brain we don't have typographical symbols, but we have 
something even better: active elements which can store information and transmit it and 
receive it from other active elements. Thus we have active symbols, rather than passive 
typographical symbols. In the brain, the rules 

Brains and Thoughts 


re mixed right in with the symbols themselves, whereas on paper, the symbols are static 
entities, and the rules are in our heads. 

It is important not to get the idea, from the rather strict nature of all ie formal systems we 
have seen, that the isomorphism between symbols and real things is a rigid, one-to-one 
mapping, like the strings which link a marionette and the hand guiding it. In TNT, the 
notion "fifty" can be expressed in different symbolic ways; for example, 


'hat these both represent the same number is not a priori clear. You can manipulate each 
expression independently, and at some point stumble cross a theorem which makes you 
exclaim, "Oh-it's that number!" 

In your mind, you can also have different mental descriptions for a single person; for 

The person whose book I sent to a friend in Poland a while back. 

The stranger who started talking with me and my friends tonight in this coffee 

:'hat they both represent the same person is not a priori clear. Both descriptions may sit in 
your mind, unconnected. At some point during the evening you may stumble across a 
topic of conversation which leads to the revelation that they designate the same person, 
making you exclaim, Oh-you're that person!" 

Not all descriptions of a person need be attached to some central symbol for that person, 
which stores the person's name. Descriptions can be manufactured and manipulated in 
themselves. We can invent nonexistent people by making descriptions of them; we can 
merge two descriptions 'hen we find they represent a single entity; we can split one 
description into two when we find it represents two things, not one-and so on. This 
calculus of descriptions" is at the heart of thinking. It is said to be intentional and not 
extensional, which means that descriptions can "float" without Being anchored down to 
specific, known objects. The intensionality of thought is connected to its flexibility; it 
gives us the ability to imagine hypothetical worlds, to amalgamate different descriptions 
or chop one description into separate pieces, and so on. 

Suppose a friend who has borrowed your car telephones you to say hat your car skidded 
off a wet mountain road, careened against a bank, .nd overturned, and she narrowly 
escaped death. You conjure up a series & images in your mind, which get progressively 
more vivid as she adds details, and in the end you "see it all in your mind's eye". Then 
she tells you hat it's all been an April Fool's joke, and both she and the car are fine! In 
many ways that is irrelevant. The story and the images lose nothing of their vividness, 
and the memory will stay with you for a long, long time. Later, you may even think of 
her as an unsafe driver because of the strength of 

Brains and Thoughts 


the first impression, which should have been wiped out when you learned it was all 
untrue. Fantasy and fact intermingle very closely in our minds, and this is because 
thinking involves the manufacture and manipulation of complex descriptions, which need 
in no way be tied down to real events or things. 

A flexible, intensional representation of the world is what thinking is all about. Now how 
can a physiological system such as the brain support such a system? 

The Brain's "Ants" 

The most important cells in the brain are nerve cells, or neurons (see Fig. 65), of which 
there are about ten billion. (Curiously, outnumbering the neurons by about ten to one are 
the glial cells, or glia. Glia are believed to play more of a supporting role to the neurons' 
starring role, and therefore we will not discuss them.) Each neuron possesses a number of 
synapses ("entry ports") and one axon ("output channel"). The input and output are 
electrochemical flows: that is, moving ions. In between the entry ports of a neuron and its 
output channel is its cell body, where "decisions" are made. 

FIGURE 65. Schematic drawing of a neuron. [Adapted From D. Wooldridge, The 
Machinery of the Brain (New York:"- McGraw-Hill, 1963), p. 6. 

Brains and Thoughts 


The type of decision which a neuron faces-and this can take place up to a thousand times 
per second-is this: whether or not to fire-that is, to ease ions down its axon, which - 
eventually will cross over into the entry its of one or more other neurons, thus causing 
them to make the same sort of decision. The decision is made in a very simple manner: if 
the sum all inputs exceeds a certain threshold, yes; otherwise, no. Some of the inputs can 
be negative inputs, which cancel out positive inputs coming from somewhere else. In any 
case, it is simple addition which rules the lowest 'el of the mind. To paraphrase Descartes' 
famous remark, "I think, therefore I sum" (from the Latin Cogito, ergo am). 

Now although the manner of making the decision sounds very simple, here is one 
fact which complicates the issue: there may be as many as 200,000 separate entry ports to 
a neuron, which means that up to 200,000 Karate summands may be involved in 
determining the neuron's next ion. Once the decision has been made, a pulse of ions 
streaks down the on towards its terminal end. Before the ions reach the end, however, ey 
may encounter a bifurcation-or several. In such cases, the single output pulse splits up as 
it moves down the bifurcating axon, and by the tine it has reached the end, "it" has 
become "they"-and they may reach their destinations at separate times, since the axon 
branches along which they travel may be of different lengths and have different 
resistivities. The important thing, though, is that they all began as one single pulse, 
moving 'ay from the cell body. After a neuron fires, it needs a short recovery time fore 
firing again; characteristically this is measured in milliseconds, so at a neuron may fire up 
to about a thousand times per second. 

Larger Structures in the Brain 

Now we have described the brain's "ants". What about "teams", or "signals"? What about 
"symbols"? We make the following observation: despite e complexity of its input, a 
single neuron can respond only in a very primitive way-by firing, or not firing. This is a 
very small amount of Formation. Certainly for large amounts of information to be carried 
or processed, many neurons must be involved. And therefore one might guess at larger 
structures, composed from many neurons, would exist, which handle concepts on a 
higher level. This is undoubtedly true, but the most naive assumption-that there is a fixed 
group of neurons for each different concept-is almost certainly false. 

There are many anatomical portions of the brain which can be distinguished from 
each other, such as the cerebrum, the cerebellum, the hypothalamus (see Fig. 66). The 
cerebrum is the largest part of the human am, and is divided into a left hemisphere and a 
right hemisphere. The outer few millimeters of each cerebral hemisphere are coated with 
a layered "bark", or cerebral cortex. The amount of cerebral cortex is the major 
distinguishing feature, in terms of anatomy, between human brains and brains of less 
intelligent species. We will not describe any of the brain's suborgans in detail because, as 
it turns out, only the roughest mapping can 

Brains and Thoughts 


FIGURE 66. The human brain, seen from the left side. It is strange that the visual area is 
in the back of the head. [From Steven Rose, The Conscious Brain, updated ed. (New 
York: Vintage, 1966), p. 50. ] 

at this time be made between such large-scale suborgans and the activities, mental or 
physical, which they are responsible for. For instance, it is known that language is 
primarily handled in one of the two cerebral hemispheres-in fact, usually the left 
hemisphere. Also, the cerebellum is the place where trains of impulses are sent off to 
muscles to control motor activity. But how these areas carry out their functions is still 
largely a mystery. 

Mappings between Brains 

Now an extremely important question comes up here. If thinking does take place in the 
brain, then how are two brains different from each other? How is my brain different from 
yours? Certainly you do not think exactly as I do, nor as anyone else does. But we all 
have the same anatomical divisions in our brains. How far does this identity of brains 
extend? Does it go to the neural level? Yes, if you look at animals on a low enough level 
of the thinking-hierarchy-the lowly earthworm, for instance. The following quote is from 
the neurophysiologist, David Hubel, speaking at a conference on communication with 
extraterrestrial intelligence: 

The number of nerve cells in an animal like a worm would be measured, I 
suppose, in the thousands. One very interesting thing is that we may point to a 
particular individual cell in a particular earthworm, and then identify the same 
cell, the corresponding cell in another earthworm of the same species.' 

Brains and Thoughts 


Earthworms have isomorphic brains! One could say, "There is only one earthworm." 

But such one-to-one mappability between individuals' brains disappears very soon as 
you ascend in the thinking-hierarchy and the number of neurons increases-confirming 
one's suspicions that there is not just one pan! Yet considerable physical similarity can be 
detected between different human brains when they are compared on a scale larger than a 
;le neuron but smaller than the major suborgans of the brain. What s this imply about how 
individual mental differences are represented in physical brain? If we looked at my 
neurons' interconnections, could we 1 various structures that could be identified as coding 
for specific things -tow, specific beliefs I have, specific hopes, fears, likes and dislikes I 
harbor? If mental experiences can be attributed to the brain, can knowledge and other 
aspects of mental life likewise be traced to specific locations de the brain, or to specific 
physical subsystems of the brain? This will be a central question to which we will often 
return in this Chapter and the next. 

Localization of Brain Processes: An Enigma 

In an attempt to answer this question, the neurologist Karl Lashley, in a series of 
experiments beginning around 1920 and running for many ,s, tried to discover where in 
its brain a rat stores its knowledge about :e running. In his book The Conscious Brain, 
Steven Rose describes Lashley's trials and tribulations this way: 

Lashley was attempting to identify the locus of memory within the cortex, and, to do so, 
first trained rats to run mazes, and then removed various cortical regions. He allowed the 
animals to recover and tested the retention of the maze-running skills. To his surprise it 
was not possible to find a particular region corresponding to the ability to remember the 
way through a maze, instead all the rats which had had cortex regions removed suffered 
some kind f impairment, and the extent of the impairment was roughly proportional to the 
amount of cortex taken off. Removing cortex damaged the motor and sensory capacities 
of the animals, and they would limp, hop, roll, or stagger, but somehow they always 
managed to traverse the maze. So far as memory 'as concerned, the cortex appeared to be 
equipotential, that is, with all regions of equal possible utility. Indeed, Lashley concluded 
rather gloomily in is last paper "In Search of the Engram", which appeared in 1950, that 
the only conclusion was that memory was not possible at all.' 

Curiously, evidence for the opposite point of view was being developed :in Canada at 
roughly the same time that Lashley was doing his last work, in late 1940's. The 
neurosurgeon Wilder Penfield was examining the reactions of patients whose brains had 
been operated on, by inserting electrodes into various parts of their exposed brains, and 
then using small electrical pulses to stimulate the neuron or neurons to which the 
electrodes been attached. These pulses were similar to the pulses which come other 
neurons. What Penfield found was that stimulation of certain 

Brains and Thoughts 


neurons would reliably create specific images or sensations in the patient. These 
artificially provoked impressions ranged from strange but indefinable fears to buzzes and 
colors, and, most impressively of all, to entire successions of events recalled from some 
earlier time of life, such as a childhood birthday party. The set of locations which could 
trigger such specific events was extremely small-basically centered upon a single neuron. 
Now these results of Penfield dramatically oppose the conclusions of Lashley, since they 
seem to imply that local areas are responsible for specific memories, after all. 

What can one make of this? One possible explanation could be that memories are coded 
locally, but over and over again in different areas of the cortex-a strategy perhaps 
developed in evolution as security against possible loss of cortex in fights, or in 
experiments conducted by neurophysiologists. Another explanation would be that 
memories can be reconstructed from dynamic processes spread over the whole brain, but 
can be triggered from local spots. This theory is based on the notion of modern telephone 
networks, where the routing of a long-distance call is not predictable in advance, for it is 
selected at the time the call is placed, and depends on the situation all over the whole 
country. Destroying any local part of the network would not block calls; it would just 
cause them to be routed around the damaged area. In this sense any call is potentially 
nonlocalizable. Yet any call just connects up two specific points; in this sense any call is 

Specificity in Visual Processing 

Some of the most interesting and significant work on localization of brain processes has 
been done in the last fifteen years by David Hubel and Torsten Wiesel, at Harvard. They 
have mapped out visual pathways in the brains of cats, starting with the neurons in the 
retina, following their connections towards the rear of the head, passing through the 
"relay station" of the lateral geniculate, and ending up in the visual cortex, at the very 
back of the brain. First of all, it is remarkable that there exist well defined neural 
pathways, in light of Lashley's results. But more remarkable are the properties of the 
neurons located at different stages along the pathway. 

It turns out that retinal neurons are primarily contrast sensors. More specifically, the 
way they act is this. Each retinal neuron is normally firing at a "cruising speed". When its 
portion of the retina is struck by light, it may either fire faster or slow down and even 
stop firing. However, it will do so only provided that the surrounding part of the retina is 
less illuminated. So this means that there are two types of neuron: ."on-center", and "off- 
center". The on-center neurons are those whose firing rate increases whenever, in the 
small circular retinal area to which they are sensitive, the center is bright but the outskirts 
are dark; the off-center neurons are those which fire faster when there is darkness in the 
center and brightness in the 

Brains and Thoughts 


outer ring. If an on-center pattern is shown to an off-center neuron, the neuron will slow 
down in firing (and vice versa). Uniform illumination will .leave both types of retinal 
neuron unaffected; they will continue to fire at cruising speed. 

From the retina, signals from these neurons proceed via the optic nerve to the lateral 
geniculate, located somewhere towards the middle of the brain. There, one can find a 
direct mapping of the retinal surface in the .use that there are lateral-geniculate neurons 
which are triggered only by specific stimuli falling on specific areas of the retina. In that 
sense, the general geniculate is disappointing; it seems to be only a "relay station", and 
not a further processor (although to give it its due, the contrast sensitivity ,ms to be 
enhanced in the lateral geniculate). The retinal image is coded a straightforward way in 
the firing patterns of the neurons in the lateral geniculate, despite the fact that the neurons 
there are not arranged on a o-dimensional surface in the form of the retina, but in a three- 
dimensional block. So two dimensions get mapped onto three, yet the formation is 
preserved: an isomorphism. There is probably some deep meaning to the change in the 
dimensionality of the representation, which is not yet fully appreciated. In any case, there 
are so many further unexplained stages of vision that we should not be disappointed but 
pleased the fact that-to some extent- we have figured out this one stage! 

From the lateral geniculate, the signals proceed back to the visual cortex. Here, some 
new types of processing occur. The cells of the visual cortex are divided into three 
categories: simple, complex, and hyper complex. Simple cells act very much like retinal 
cells or lateral geniculate [Is: they respond to point-like light or dark spots with 
contrasting surrounds, in particular regions of the retina. Complex cells, by contrast, 
usually receive input from a hundred or more other cells, and they detect light dark bars 
oriented at specific angles on the retina (see Fig. 67). Hyper complex cells respond to 
corners, bars, or even "tongues" moving in specific directions (again see Fig. 67). These 
latter cells are so highly specialized at they are sometimes called "higher-order hyper 
complex cells". 

A "Grandmother Cell"? 

Because of the discovery of cells in the visual cortex which can be triggered stimuli of 
ever-increasing complexity, some people have wondered if things are not leading in the 
direction of "one cell, one concept" -for ample, you would have a "grandmother cell" 
which would fire if, and only if, your grandmother came into view. This somewhat 
humorous ample of a "superhypercomplex cell" is not taken very seriously. Rower, it is 
not obvious what alternative theory seems reasonable. One possibility is that larger neural 
networks are excited collectively by sufficiently complex visual stimuli. Of course, the 
triggering of these larger multineuron units would somehow have to come from 
integration of signals emanating from the many hyper complex cells. How this might be 
done nobody knows> Just when we seem to be approaching the threshold where 

Brains and Thoughts 



(a) Complex cell (area 1 7) . (h) Hypercomplex cell complex cell 

(area 19) (area 1729) 


Stimulus; Response Stimulus; Response 



Stimulus; Response Stimulus; Response 




St l ong 

| ^ Strong | f | 

J^j/ero | [ zero | ^ 

Etmiap Crj.„„*.i f*>ir,*r»K he ffrtmn uimhb neurons. 








FIGURE 67. Responses to patterns by certain sample neurons. 

(a) This edge-detecting neuron looks for vertical edges with light on the left 
and dark on the right. The first column shows how the orientation of an 
edge is relevant to this neuron. The second column shows how the position 
of the edge within the field is irrelevant, for this particular neuron, (b) 
Showing how a hyper complex cell responds more selectively: here, only 
when the descending tongue is in the middle of the field, (c) The responses 
of a hypothetical "grandmother cell" to various random stimuli; the reader 
may enjoy pondering how an "octopus cell" would respond to the same 

"symbol" might emerge from "signal", the trail gets lost-a tantalizingly unfinished story. 
We will return to this story shortly, however, and try to fill in some of it. 

Earlier I mentioned the coarse-grained isomorphism between all human brains which 
exists on a large anatomical scale, and the very fine-grained, neural-level isomorphism 
which exists between earthworm brains. It is quite interesting that there is also an 
isomorphism between the visual processing apparatus of cat, monkey, and human, the 
"grain" of which is somewhere between coarse and fine. Here is how that isomorphism 
works. First of all, all three species have "dedicated" areas of cortex at the back of their 
brains where visual processing is done: the visual cortex. Secondly, in 

Brains and Thoughts 


each of them, the visual cortex breaks up into three subregions, called areas 18, and 19 of 
the cortex. These areas are still universal, in the sense that y can be located in the brain of 
any normal individual in any of the three ties. Within each area you can go still further, 
reaching the "columnar" organization of the visual cortex. Perpendicular to the surface of 
the (ex, moving radially inwards towards the inner brain, visual neurons are inged in 
"columns"-that is, almost all connections move along the ial, columnar direction, and not 
between columns. And each column ps onto a small, specific retinal region. The number 
of columns is not same in each individual, so that one can't find "the same column", ally, 
within a column, there are layers in which simple neurons tend to found, and other layers 
in which complex neurons tend to be found, to hypercomplex neurons tend to be found in 
areas 18 and 19 predominately, while the simple and complex ones are found mostly in 
area 17.) appears that we run out of isomorphisms at this level of detail. From here down 
to the individual neuron level, each individual cat, monkey, or man has a completely 
unique pattern-somewhat like a fingerprint or a signature. 

One minor but perhaps telling difference between visual processing in ;'brains and 
monkeys' brains has to do with the stage at which informal from the two eyes is 
integrated to yield a single combined higher-level lal. It turns out that it takes place 
slightly later in the monkey than in the cat, which gives each separate eye's signal a 
slightly longer time to get processed by itself. This is not too surprising, since one would 
expect that higher a species lies in the intelligence hierarchy, the more complex will the 
problems which its visual system will be called upon to handle; and before signals ought 
to pass through more and more early processing ore receiving a final "label". This is quite 
dramatically confirmed by observations of the visual abilities of a newborn calf, which 
seems to be born with as much power of visual discrimination as it will ever have. It will 
shy away from people or dogs, but not from other cattle. Probably its entire visual system 
is "hard-wired" before birth, and involves relatively little optical processing. On the other 
hand, a human's visual system, so deeply ant on the cortex, takes several years to reach 

Funneling into Neural Modules 

A puzzling thing about the discoveries so far made about the organization the brain is 
that few direct correspondences have been found between large-scale hardware and high- 
level software. The visual cortex, for instance, is a large-scale piece of hardware, which is 
entirely dedicated to a it software purpose-the processing of visual information-yet all of 
processing so far discovered is still quite low-level. Nothing approaching recognition of 
objects has been localized in the visual cortex. This means that no one knows where or 
how the output from complex and hypercomplex cells gets transformed into conscious 
recognition of shapes, 

Brains and Thoughts 


rooms, pictures, faces, and so on. People have looked for evidence of the 'Tunneling" of 
many low-level neural responses into fewer and fewer higher-level ones, culminating in 
something such as the proverbial grandmother cell, or some kind of multineuron network, 
as mentioned above. It is evident that this will not be found in some gross anatomical 
division of the brain, but rather in a more microscopic analysis. 

One possible alternative to the the grandmother cell might be a fixed set of neurons, say 
a few dozen, at the thin end of the "funnel", all of which fire when Granny comes into 
view. And for each different recognizable object, there would be a unique network and a 
funneling process that would focus down onto that network. There are more complicated 
alternatives along similar lines, involving networks which can be excited in different 
manners, instead of in a fixed manner. Such networks would be the "symbols" in our 

But is such funneling necessary? Perhaps an object being looked at is implicitly 
identified by its "signature" in the visual cortex-that is, the collected responses of simple, 
complex, and hypercomplex cells. Perhaps the brain does not need any further recognizer 
for a particular form. This theory, however, poses the following problem. Suppose you 
are looking at a scene. It registers its signature on your visual cortex; but then how do you 
get from that signature to a verbal description of the scene? For instance, the paintings of 
Edouard Vuillard, a French post-impressionist, often take a few seconds of scrutiny, and 
then suddenly a human figure will jump out at you. Presumably the signature gets 
imprinted on the visual cortex in the first fraction of a second-but the picture is only 
understood after a few seconds. This is but one example of what is actually a common 
phenomenon-a sensation of something "crystallizing" in your mind at the moment of 
recognition, which takes place not when the light rays hit your retina, but sometime later, 
after some part of your intelligence has had a chance to act on the retinal signals. 

The crystallization metaphor yields a pretty image derived from statistical mechanics, 
of a myriad microscopic and uncorrected activities in a medium, slowly producing local 
regions of coherence which spread and enlarge; in the end, the myriad small events will 
have performed a complete structural revamping of their medium from the bottom up, 
changing' it from a chaotic assembly of independent elements into one large, coherent, 
fully linked structure. If one thinks of the early neural activities as independent, and of 
the end result of their many independent firings as the triggering of a well-defined large 
"module" of neurons, then the word "crystallization" seems quite apt. 

Another argument for funneling is based on the fact that there are a myriad distinct 
scenes which can cause you to feel you have perceived the same object-for example, your 
grandmother, who may be smiling or frowning, wearing a hat or not, in a bright garden or 
a dark train station, seen from near or far, from side or front, and so on. All these scenes 
produce extremely different signatures on the visual cortex; yet all of them could prompt 
you to say "Hello, Granny." So a funneling process must take 

Brains and Thoughts 


place at some point after the reception of the visual signature and before e words are 
uttered. One could claim that this funneling is not part of the perception of Granny, but 
just part of verbalization. But it seems quite unnatural to partition the process that way, 
for you could internally use the formation that it is Granny without verbalizing it. It 
would be very it unwieldy to handle all of the information in the entire visual cortex, 
when much of it could be thrown away, since you don't care about where shadows fall or 
how many buttons there are on her blouse, etc. 

Another difficulty with a non-funneling theory is to explain how there in be different 
interpretations for a single signature-for example, the Escher picture Convex a4 Concave 
(Fig. 23). Just as it seems obvious to us tat we do not merely perceive dots on a television 
screen, but chunks, likewise it seems ridiculous to postulate that perception has taken 
place hen a giant dot-like "signature" has been created on the visual cortex, here must be 
some funneling, whose end result is to trigger some specific modules of neurons, each of 
which is associated with the concepts-the funks-in the scene. 

Modules Which Mediate Thought Processes 

Thus we are led to the conclusion that for each concept there is a fairly ell-defined 
module which can be triggered-a module that consists of a nail group of neurons-a 
"neural complex" of the type suggested earlier, problem with this theory-at least if it is 
taken naively-is that it would suggest that one should be able to locate such modules 
somewhere within to brain. This has not yet been done, and some evidence, such as the 
experiments by Lashley, points against localization. However, it is still too early to tell. 
There may be many copies of each module spread around, or modules may overlap 
physically; both of these effects would tend to obscure any division of neurons into 
"packets". Perhaps the complexes are like very thin pancakes packed in layers which 
occasionally pass through each other; perhaps they are like long snakes which curl 
around each other, here and there flattening out, like cobras' heads; perhaps they are like 
spiderwebs; or perhaps they are circuits in which signals travel round id round in shapes 
stranger than the dash of a gnat-hungry swallow, here is no telling. It is even possible that 
these modules are software, ether than hardware, phenomena-but this is something which 
we will discuss later 

There are many questions that come to mind concerning these hypothesized neural 
complexes. For instance: 

Do they extend into the lower regions of the brain, such as the 

midbrain, the hypothalamus, etc.? 
Can a single neuron belong to more than one such complex? 
To how many such complexes can a single neuron belong? 
By how many neurons can such complexes overlap? 

Brains and Thoughts 


Are these complexes pretty much the same for everybody? 

Are corresponding ones found in corresponding places in different 

people's brains? 
Do they overlap in the same way in everybody's brain? 

Philosophically, the most important question of all is this: "hat would the existence of 
modules-for instance, a grandmother module-tell us? Would this give us any insight into 
the phenomenon of our own consciousness? Or would it still leave us as much in the dark 
about what consciousness is, as does knowledge that a brain is built out of neurons and 
glia? As you might guess from reading the Ant Fugue, my feeling is that it would go a 
long way towards giving us an understanding of the phenomenon of consciousness. The 
crucial step that needs to be taken is from a low-level-neuron-by-neuron-description of 
the state of a brain, to a high-level-module-by-module-description of the same state of the 
same brain. Or, to revert to the suggestive terminology of the Ant Fugue, we want to shift 
the description of the brain state from the signal level to the symbol, level. 

Active Symbols 

Let us from now on refer to these hypothetical neural complexes, neural modules, 
neural packets, neural networks, multineuron units-call them what you will, whether they 
come in the form of pancakes, garden rakes, rattlesnakes, snowflakes, or even ripples on 
lakes-as symbols. A description of a brain state in terms of symbols was alluded to in the 
Dialogue. What would such a description be like? What kinds of concepts is it reasonable 
to think actually might be "symbolized"? What kinds of interrelations would symbols 
have? And what insights would this whole picture provide into consciousness? 

The first thing to emphasize is that symbols can be either dormant, or awake (activated). 
An active symbol is one which has been triggered-that is, one in which a threshold 
number of neurons have been caused to fire by stimuli coming from outside. Since a 
symbol can be triggered in many different ways, it can act in many different ways when 
awakened. This suggests that we should think of a symbol not as a fixed entity, but as a 
variable entity. Therefore it would not suffice to describe a brain state by saying 
"Symbols A, B, N are all active"; rather, we would have to supply in addition a set of 
parameters for each active symbol, characterizing some aspects of the symbol's internal 
workings. It is an interesting question whether in each symbol there are certain core 
neurons, which invariably fire when the symbol is activated. If such a core set of neurons 
exists, we might refer to it as the "invariant core" of the symbol. It is tempting to assume 
that each time you think of, say, a waterfall, some fixed neural process is repeated, 
without doubt embellished in different ways depending on the context, but reliably 
occurring. However, it is not clear that this must be so. 

Brains and Thoughts 


Now what does a symbol do, when awakened? A low-level description would say, 
"Many of its neurons fire." But this no longer interests us. The high-level description 
should eliminate all reference to neurons, and concentrate exclusively on symbols. So a 
high-level description of what makes a symbol active, as distinguished from dormant, 
would be, "It sends out messages, or signals, whose purpose is to try to awaken, or 
trigger, other symbols." Of course these messages would be carried as streams of nerve 
impulses, by neurons-but to the extent that we can avoid such phraseology, we should, 
for it represents a low-level way of looking at things, and we hope that we can get along 
on purely a high level. In other words, we hope at thought processes can be thought of as 
being sealed off from neural events in the same way that the behavior of a clock is sealed 
off from the laws of quantum mechanics, or the biology of cells is sealed off from the 
laws of quarks. 

But what is the advantage of this high-level picture? Why is it better to say, "Symbols A 
and B triggered symbol C" than to say, "Neurons 183 through 612 excited neuron 75 and 
caused it to fire"? This question was answered in the Ant Fugue: It is better because 
symbols symbolize things, and neurons don't. Symbols are the hardware realizations of 
concepts. Whereas group of neurons triggering another neuron corresponds to no outer 
event, the triggering of some symbol by other symbols bears a relation to events in the 
real world-or in an imaginary world. Symbols are related to each other by the messages 
which they can send back and forth, in such a way that their triggering patterns are very 
much like the large-scale events rich do happen in our world, or could happen in a world 
similar to ours, essence, meaning arises here for the same reason as it did in the -system- 
isomorphism; only here, the isomorphism is infinitely more complex, subtle, delicate, 
versatile, and intensional. 

Incidentally, the requirement that symbols should be able to pass sophisticated 
messages to and fro is probably sufficient to exclude neurons themselves from playing 
the role of symbols. Since a neuron has only a single way of sending information out of 
itself, and has no way of selectively selecting a signal now in one direction, now in 
another, it simply does not have the kind of selective triggering power which a symbol 
must have to act e an object in the real world. I n his book The Insect Societies, E. O. 
Wilson makes a similar point about how messages propagate around inside ant colonies: 

[Mass communication] is defined as the transfer, among groups, of information that a 
single individual could not pass to another.' 

It is not such a bad image, the brain as an ant colony! 

The next question-and an extremely important one it is, too concerns the 
nature and "size" of the concepts which are represented in the tin by single 
symbols. About the nature of symbols there are questions like this: Would there be 
a symbol for the general notion of waterfalls, or would there be different symbols 
for various specific waterfalls? Or would both of these alternatives be realized? 
About the "size" of symbols, there are questions like this: Would there be a symbol 
for an entire story? Or for a 

Brains and Thoughts 


melody? Or a joke? Or is it more likely that there would only be symbols for concepts 
roughly the size of words, and that larger ideas, such as phrases or sentences, would be 
represented by concurrent or sequential activation of various symbols? 

Let us consider the issue of the size of concepts represented by symbols. Most thoughts 
expressed in sentences are made up out of basic, quasi-atomic components which we do 
not usually analyze further. These are of word size, roughly-sometimes a little longer, 
sometimes a little shorter. For instance, the noun "waterfall", the proper noun "Niagara 
Falls", the past-tense suffix "-ed", the verb "to catch up with", and longer idiomatic 
phrases are all close to atomic. These are typical elementary brush strokes which we use 
in painting portraits of more complex concepts, such as the plot of a movie, the flavor of 
a city, the nature of consciousness, etc. Such complex ideas are not single brush strokes.. 
It seems reasonable to think that the brush strokes of language are also brush strokes of 
thought, and therefore that symbols represent concepts of about this size. Thus a symbol 
would be roughly something for which you know a word or stock phrase, or with which 
you associate a proper name. And the representation in the brain of a more complex idea, 
such as a problem in a love affair, would be a very complicated sequence of activations 
of various symbols by other symbols. 

Classes and Instances 

There is a general distinction concerning thinking: that between categories and 
individuals, or classes and instances. (Two other terms sometimes used are "types" and 
"tokens".) It might seem at first sight that a given symbol would inherently be either a 
symbol for a class or a symbol for an instance-but that is an oversimplification. Actually, 
most symbols may play either role, depending on the context of their activation. For 
example, look at the list below: 

(1) a publication 
(2) a newspaper 

(3) The San Francisco Chronicle 

(4) the May 18 edition of the Chronicle 

(5) my copy of the May 18 edition of the Chronicle 

(6) my copy of the May 18 edition of the Chronicle as 

it was when I first picked it up (as contrasted with 
my copy as it was a few days later: in my fireplace, 

Here, lines 2 to 5 all play both roles. Thus, line 4 is an instance of of the general class of 
line 3, and line 5 is an instance of line 4. Line 6 is a special kind of instance of a class: a 
manifestation. The successive stages of an object during its life history are its 
manifestations. It is interesting to wonder if the cows on a farm perceive the invariant 
individual underneath all the manifestations of the jolly farmer who feeds then hay. 

Brains and Thoughts 


The Prototype Principle 

The list above seems to be a hierarchy of generality-the top being a very road conceptual 
category, the bottom some very humble particular thing located in space and time. 
However, the idea that a "class" must always be enormously broad and abstract is far too 
limited. The reason- is that our thought makes use of an ingenious principle, which might 
be called the prototype principle: 

The most specific event can serve as a general example 
of a class of events. 

Everyone knows that specific events have a vividness which imprints them i strongly on 
the memory that they can later be used as models for other vents which are like them in 
some way. Thus in each specific event, there is the germ of a whole class of similar 
events. This idea that there is generality in the specific is of far-reaching importance. 

Now it is natural to ask: Do the symbols in the brain represent classes, r instances? Are 
there certain symbols which represent only classes, while other symbols represent only 
instances? Or can a single symbol serve duty either as a class symbol or instance symbol, 
depending which parts of it are activated? The latter theory seems appealing; one might 
think that a "light" activation of a symbol might represent a class, and that a deeper, or 
more complex, activation would contain more detailed internal neural firing patterns, and 
hence would represent an instance. But on second thought, its is crazy: it would imply, 
for example, that by activating the symbol for publication" in a sufficiently complex way, 
you would get the very complex symbol which represents a specific newspaper burning 
in my fireplace. And very other possible manifestation of every other piece of printed 
matter would be represented internally by some manner of activating the single symbol 
for "publication". That seems much too heavy a burden to place on to single symbol 
"publication". One must conclude, therefore, that finance symbols can exist side by side 
with class symbols, and are not just lodes of activation of the latter. 

The Splitting-off of Instances from Classes 

On the other hand, instance symbols often inherit many of their properties from the 
classes to which those instances belong. If I tell you I went to see a Movie, you will begin 
"minting" a fresh new instance symbol for that particular movie; but in the absence of 
more information, the new instance symbol will have to lean rather heavily on your pre- 
existing class symbol for movie". Unconsciously, you will rely on a host of 
presuppositions about at movie-for example, that it lasted between one and three hours, 
that it was shown in a local theater, that it told a story about some people, and so i. These 
are built into the class symbol as expected links to other symbols e., potential triggering 
relations), and are called default options. In any 

Brains and Thoughts 


freshly minted instance symbol, the default options can easily be overridden, but unless 
this is explicitly done, they will remain in the instance symbol, inherited from its class 
symbol. Until they are overridden, they provide some preliminary basis for you to think 
about the new instance for example, the movie I went to see-by using the reasonable 
guesses which are supplied by the "stereotype", or class symbol. 

A fresh and simple instance is like a child without its own ideas or experiences-it relies 
entirely on its parents' experiences and opinions and just parrots them. But gradually, as it 
interacts more and more with the rest of the world, the child acquires its own 
idiosyncratic experiences and inevitably begins to split away from the parents. 
Eventually, the child becomes a full-fledged adult. In the same way, a fresh instance can 
split off from its parent class over a period of time, and become a class, or prototype, in 
its own right. 

For a graphic illustration of such a splitting-off process, suppose that some Saturday 
afternoon you turn on your car radio, and happen to tune in on a football game between 
two "random" teams. At first you do not know the names of the players on either team. 
All you register, when the announcer says, "Palindromi made the stop on the twenty- 
seven yard line, and that brings up fourth down and six to go," is that some player 
stopped some other player. Thus it is a case of activation of the class symbol "football 
player", with some sort of coordinated activation of the symbol for tackling. But then as 
Palindromi figures in a few more key plays, you begin building up a fresh instance 
symbol for him in particular, using his name, perhaps, as a focal point. This symbol is 
dependent, like a child, on the class symbol for "football player": most of your image of 
Palindromi is supplied by your stereotype of a football player as contained in the 
"football player" symbol. But gradually, as more information comes to you, the 
"Palindromi" symbol becomes more autonomous, and relies less and less on concurrent 
activation of its parent class symbol. This may happen in a few minutes, as Palindromi 
makes a few good plays and stands out. His teammates may still all be represented by 
activations of the class symbol, however. Eventually, perhaps after a few days, when you 
have read some articles in the sports section of your paper, the umbilical cord is broken, 
and Palindromi can stand on his own two feet. Now you know such things as his home 
town and his major in college; you recognize his face; and so on. At this point, 
Palindromi is no longer conceived of merely as a football player, but as a human being 
who happens also to be a football player. "Palindromi" is an instance symbol which can 
become active while its parent class symbol (football player) remains dormant. 

Once, the Palindromi symbol was a satellite orbiting around its mother symbol, like an 
artificial satellite circling the Earth, which is so much bigger and more massive. Then 
there came an intermediate stage, where one symbol was more important than the other, 
but they could be seen as orbiting around each other-something like the Earth and the 
Moon. Finally, the new symbol becomes quite autonomous; now it might easily serve as 
a class symbol around which could start rotating new satellites- 

Brains and Thoughts 


symbols for other people who are less familiar but who have something in common with 
Palindromi, and for whom he can serve as a temporary stereotype, until you acquire more 
information, enabling the new symbols so to become autonomous. 

The Difficulty of Disentangling Symbols from Each Other 

These stages of growth and eventual detachment of an instance from a ass will be 
distinguishable from each other by the way in which the symbols involved are linked. 
Sometimes it will no doubt be very difficult to 1 1 just where one symbol leaves off and 
the other one begins. How "active" the one symbol, compared to the other? If one can be 
activated independently of the other, then it would be quite sensible to call them 

We have used an astronomy metaphor above, and it is interesting that to problem of the 
motion of planets is an extremely complex one-in fact the general problem of three 
gravitationally interacting bodies (such as the Earth, Moon, and Sun) is far from solved, 
even after several centuries of work. One situation in which it is possible to obtain good 
approximate solutions, however, is when one body is much more massive than the other 
two (here, the Sun); then it makes sense to consider that body as stationary, with the other 
two rotating about it: on top of this can finally be added the interaction between the two 
satellites. But this approximation depends on breaking up the system into the Sun, and a 
"cluster": the Earth-Moon 'stem. This is an approximation, but it enables the system to be 
understood quite deeply. So to what extent is this cluster a part of reality, and to hat 
extent is it a mental fabrication, a human imposition of structure on me universe? This 
problem of the "reality" of boundaries drawn between hat are perceived to be autonomous 
or semi-autonomous clusters will create endless trouble when we relate it to symbols in 
the brain. 

One greatly puzzling question is the simple issue of plurals. How do we visualize, say, 
three dogs in a teacup? Or several people in an elevator? Do we begin with the class 
symbol for "dog" and then rub three "copies" off of it? That is, do we manufacture three 
fresh instance symbols using the class 'symbol "dog" as template? Or do we jointly 
activate the symbols "three" and log"? By adding more or less detail to the scene being 
imagined, either theory becomes hard to maintain. For instance, we certainly do not have 
a separate instance symbol for each nose, mustache, grain of salt, etc., that we have ever 
seen. We let class symbols take care of such numerous items, and when we pass people 
on the street who have mustaches, we somehow just activate the "mustache" class 
symbol, without minting fresh instance symbols, unless we scrutinize them carefully. 

On the other hand, once we begin to distinguish individuals, we cannot rely on a single 
class symbol (e.g., "person") to timeshare itself among all the different people. Clearly 
there must come into existence separate stance symbols for individual people. It would be 
ridiculous to imagine 

Brains and Thoughts 


that this feat could be accomplished by 'juggling"-that is, by the single class symbol 
flitting back and forth between several different modes of activation (one for each 

Between the extremes, there must be room for many sorts of intermediate cases. There 
may be a whole hierarchy of ways of creating the class-instance distinction in the brain, 
giving rise to symbols-and symbol organizations-of varying degrees of specificity. The 
following different kinds of individual and joint activation of symbols might be 
responsible for mental images of various degrees of specificity: 

(1) various different modes or depths of activation of a single class symbol: 

(2) simultaneous activation of several class symbols in some in some coordinated 


(3) activation of a single instance symbol: 

(4) activation of a single instance symbol in conjunction with activation of several 

class symbols: 

(5) simultaneous activation of several instance symbols and several class symbols 

in some coordinated manner. 

This brings us right hack to the question: "When is a symbol a distinguishable 
subsystem of the brain For instance, consider the second example-simultaneous 
activation of several class symbols in some coordinated manner. This could easily be 
what happens when "piano sonata" is the concept under consideration (the symbols for 
"piano" and "sonata" being at least two of the activated symbols). But if this pair of 
symbols gets activated in conjunction often enough, it is reasonable to assume that the 
link between them will become strong enough that they will act as a unit, when activated 
together in the proper way. So two or more symbols can act as one, under the proper 
conditions, which means that the problem of enumerating the number of symbols in the 
brain is trickier than one might guess. 

Sometimes conditions can arise where two previously unlinked symbols get activated 
simultaneously and in a coordinated fashion. They may fit together so well that it seems 
like an inevitable union, and a single new symbol is formed by the tight interaction of the 
two old symbols. If this happens, would it be fair to say that the new symbol "always had 
been there but never had been activated"-or should one say that it has been "created"? 

In case this sounds too abstract, let us take a concrete example: the Dialogue Crab 
Canon. In the invention of this Dialogue, two existing symbols-that for "musical crab 
canon", and that for "verbal dialogue "had to be activated simultaneously and in some 
way forced to interact. Once this was done, 'the rest was quite inevitable: a new symbol-a 
class symbol-was born from the interaction of these two, and from then on it was able to 
be activated on its own. Now had it always been a dormant symbol in my brain? If so, 
then it must have also been a dormant symbol in 

Brains and Thoughts 


the brain of every human who ever had its component symbols, even if it never was 
awakened in them. This would mean that to enumerate the symbols in anyone's brain, one 
would have to count all dormant symbols-all possible combinations and permutations of 
all types of activations of all known symbols. This would even include those fantastic 
creatures of software that one's brain invents when one is asleep-the strange mixtures of 
ideas which wake up when their host goes to sleep ... The existence of these "potential 
symbols" shows that it is really a huge oversimplification to imagine that the brain is a 
well-defined collection of symbols in well-defined states of activation. It is much harder 
than that to pin down a brain state on the symbol level. 

Symbols -Software or Hardware? 

With the enormous and ever-growing repertoire of symbols that exist in each brain, you 
might wonder whether there eventually comes a point when the brain is saturated-when 
there is just no more room for a new symbol. This would come about, presumably, if 
symbols never overlapped each other-if a given neuron never served a double function, so 
that symbols would be like people getting into an elevator. "Warning: This brain has a 
maximum capacity of 350,275 symbols!" 

This is not a necessary feature of the symbol model of brain function, however. In fact, 
overlapping and completely tangled symbols are probably the rule, so that each neuron, 
far from being a member of a unique symbol, is probably a functioning part of hundreds 
of symbols. This gets a little disturbing, because if it is true, then might it not just as 
easily be the case that each neuron is part of every single symbol? If that were so, then 
there would be no localizability whatsoever of symbols-every symbol would be identified 
with the whole of the brain. This would account for results like Lashley's cortex removal 
in rats-but it would also mean abandonment of our original idea of breaking the brain up 
into physically distinct subsystems. Our earlier characterization of symbols as "hardware 
realizations of concepts" could at best be a great oversimplification. In fact, if every 
symbol were made up of the same component neurons as every other symbol, then what 
sense would it make to speak of distinct symbols at all? What would be the signature of a 
given symbol's activation-that is, how could the activation of symbol A be distinguished 
from the activation of symbol B? Wouldn't our whole theory go down the drain? And 
even if there is not a total overlap of symbols, is our theory not more and more difficult to 
maintain, the more that symbols do overlap? (One possible way of portraying 
overlapping symbols is shown in Figure 68.) 

There is a way to keep a theory based on symbols even if physically, they overlap 
considerably or totally. Consider the' surface of a pond, which can support many different 
types of waves or ripples. The hardware namely the water itself-is the same in all cases, 
but it possesses different possible modes of excitation. Such software excitations of the 

Brains and Thoughts 


FIGURE 68. In this schematic diagram, neurons are imagined as laid out as dots in one plane. 
Two overlapping neural pathways are shown in different shades of gray. It may happen that two 
independent "neural flashes" simultaneously race down these two pathways, passing through one 
another like two ripples on a pond's surface (as in Fig. 52). This is illustrative of the idea of two 
"active symbols" which share neurons and which may even be simultaneously activated. [From 
John C. Eccles, Facing Reality (New York: Springer Verlag, 1970), p.2L] 

hardware can all be distinguished from each other. By this analogy, I do not mean to go 
so far as to suggest that all the different symbols are just different kinds of "waves" 
propagating through a uniform neural medium which admits of no meaningful division 
into physically distinct symbols. But it may be that in order to distinguish one symbol's 
activation from that of another symbol, a process must be carried out which involves not 
only locating the neurons which are firing, but also identifying very precise details of the 
timing of the firing of those neurons. That is, which neuron preceded which other neuron, 
and by how much? How many times a second was a particular neuron firing? Thus 
perhaps several symbols can coexist in the same set of neurons by having different 
characteristic neural firing patterns. The difference between a theory having physically 
distinct symbols, and a theory having overlapping symbols which are distinguished from 
each other by modes of excitation, is that the former gives hardware realizations of 
concepts, while the latter gives partly hardware, partly software realizations of concepts. 

Brains and Thoughts 


Liftability of Intelligence 

Thus we are left with two basic problems in the unraveling of thought processes, as they 
take place in the brain. One is to explain how the A,-level traffic of neuron firings gives 
rise to the high-level traffic of symbol activations. The other is to explain the high-level 
traffic of symbol activation in its own terms-to make a theory which does not talk about 
the ,v-level neural events. If this latter is possible-and it is a key assumption the basis of 
all present research into Artificial Intelligence-then intelligence can be realized in other 
types of hardware than brains. Then intelligence will have been shown to be a property 
that can be "lifted" right out of e hardware in which it resides-or in other words, 
intelligence will be a software property. This will mean that the phenomena of 
consciousness and intelligence are indeed high-level in the same sense as most other 

FIGURE 69. The construction of an arch by workers of the termite Macrotermes belosus. Each 
column is built up by the addition of pellets of soil and excrement. On the outer part of the left 
column a worker is seen depositing a round fecal pellet. Other workers, having carried pellets in 
their mandibles up the columns, are now placing them at the growing ends of ' columns. When a 
column reaches a certain height the termites, evidently guided by odor, ;in to extend it at an angle 
in the direction of a neighboring column. A completed arch is shown in the background. 
[Drawing by Turid Holldobler; from E. 0. Wilson, The Insect Societies Cambridge, Mass.: 
Harvard University Press, 1971), p. 230] 

Brains and Thoughts 


phenomena of nature: they have their own high-level laws which depend on, yet are 
"liftable" out of, the lower levels. If, on the other hand, there is absolutely no way to 
realize symbol-triggering patterns without having all the hardware of neurons (or 
simulated neurons), this will imply that intelligence is a brain-bound phenomenon, and 
much more difficult to unravel than one which owes its existence to a hierarchy of laws 
on several different levels. 

Here we come back to the mysterious collective behavior of ant colonies, which can build 
huge and intricate nests, despite the fact that the roughly 100,000 neurons of an ant brain 
almost certainly do not carry any. information about nest structure. How, then, does the 
nest get created? Where does the information reside? In particular, ponder where the 
information describing an arch such as is shown in Figure 69 can be found. Somehow, it 
must be spread about in the colony, in the caste distribution, the age distribution-and 
probably largely in the physical properties of the ant-body itself. That is, the interaction 
between ants is determined just as much by their six-leggedness and their size and so on, 
as by the information stored in their brain. Could there be an Artificial Ant Colony? 

Can One Symbol Be Isolated? 

Is it possible that one single symbol could be awakened in isolation from all others? 
Probably not. Just as objects in the world always exist in a context of other objects, so 
symbols are always connected to a constellation of other symbols. This does not 
necessarily mean that symbols can never be disentangled from each other. To make a 
rather simple analogy, males and females always arise in a species together: their roles 
are completely intertwined, and yet this does not mean that a male cannot be 
distinguished from a female. Each is reflected in the other, as the beads in Indra's net 
reflect each other. The recursive intertwining of the functions F(n) and M(n) in Chapter V 
does not prevent each function from having its own characteristics. The intertwining of F 
and M could be mirrored in a pair of RTN's which call each other. From this we can jump 
to a whole network of ATN's intertwined with each other-a heterarchy of interacting 
recursive procedures. Here, the meshing is so inherent that no one ATN could be 
activated in isolation; yet its activation may be completely distinctive, not confusable 
with that of any other of the ATN's. It is not such a bad image, the brain as an ATN- 

Likewise, symbols, with all their multiple links to each other, are meshed together and 
yet ought to be able to be teased apart. This might involve identifying a neural network, a 
network plus a mode of excitation-or possibly something of a completely different kind. 
In any case, if symbols are part of reality, presumably there exists a natural way to chart 
them out in a real brain. However, if some symbols were finally identified in a brain, this 
would not mean that any one of them could be awakened in isolation. 

Brains and Thoughts 


The fact that a symbol cannot be awakened in isolation does not diminish the 
separate identity of the symbol; in fact, quite to the contrary: a symbol's identity lies 
precisely in its ways of being connected (via potential triggering links) to other symbols. 
The network by which symbols can potentially trigger each other constitutes the brain's 
working model of the real universe, as well as of the alternate universes which it 
considers (and which are every bit as important for the individual's survival in the real 
world as the real world is). 

The Symbols of Insects 

Our facility for making instances out of classes and classes out of instances lies at the 
basis of our intelligence, and it is one of the great differences between human thought and 
the thought processes of other animals. Not that I have ever belonged to another species 
and experienced at first hand how it feels to think their way-but from the outside it is 
apparent that no other species forms general concepts as we do, or imagines hypothetical 
worlds-variants on the world as it is, which aid in figuring out which future pathway to 
choose. For instance, consider the celebrated "language of the bees" -information-laden 
dances which are performed by worker bees returning to the hive, to inform other bees of 
the location of nectar. While there may be in each bee a set of rudimentary symbols 
which are activated by such a dance, there is no reason to believe that a bee has an 
expandable vocabulary of symbols. Bees and other insects do not seem to have the power 
to generalize-that is, to develop new class symbols from instances which we would 
perceive as nearly identical. 

A classic experiment with solitary wasps is reported in Dean Wooldridge's book, 
Mechanical Man, from which I quote: 

When the time comes for egg laying, the wasp Sphex builds a burrow for the 
purpose and seeks out a cricket which she stings in such a way as to paralyze but not 
kill it. She drags the cricket into the burrow, lays her eggs alongside, closes the 
burrow, then flies away, never to return. In due course, the eggs hatch and the wasp 
grubs feed off the paralyzed cricket, which has not decayed, having been kept in the 
wasp equivalent of a deepfreeze. To the human mind, such an elaborately organized 
and seemingly purposeful routine conveys a convincing flavor of logic and 
thoughtfulness-until more details are examined. For example, the wasp's routine is to 
bring the paralyzed cricket to the burrow, leave it on the threshold, go inside to see 
that all is well, emerge, and then drag the cricket in. If the cricket is moved a few 
inches away while the wasp is inside making her preliminary inspection, the wasp, 
on emerging from the burrow, will bring the cricket back to the threshold, but not 
inside, and will then repeat the preparatory procedure of entering the burrow to see 
that everything is all right. If again the cricket is removed a few inches while the 
wasp is inside, once again she will move the cricket up to the threshold and reenter 
the burrow for a final check. The wasp never thinks of pulling the cricket straight in. 
On one occasion this procedure was repeated forty times, always with the same 

Brains and Thoughts 


This seems to be completely hard-wired behavior. Now in the wasp brain, there may be 
rudimentary symbols, capable of triggering each other; but there is nothing like the 
human capacity to see several instances as instances of an as-yet-unformed class, and 
then to make the class symbol; nor is there anything like the human ability to wonder, 
"What if I did this-what would ensue in that hypothetical world%" This type of thought 
process requires an ability to manufacture instances and to manipulate them as if they 
were symbols standing for objects in a real situation, although that situation may not be 
the case, and may never be the case. 

Class Symbols and Imaginary Worlds 

Let us reconsider the April Fool's joke about the borrowed car, and the images conjured 
up in your mind during the telephone call. To begin with, you need to activate symbols 
which represent a road, a car, a person in a car. Now the concept "road" is a very general 
one, with perhaps several stock samples which you can unconsciously pull out of 
dormant memory when the occasion arises. "Road" is a class, rather than an instance. As 
you listen to the tale, you quickly activate symbols which are instances with gradually 
increasing-specificity. For instance, when you learn that the road' was wet, this conjures 
up a more specific image, though you realize that it is most likely quite different from the 
actual road where the incident took place. But that is not important; what matters is 
whether your symbol is sufficiently well suited for the story-that is, whether the symbols 
which it can trigger are the right kind. 

As the story progresses, you fill in more aspects of this road: there is a high bank against 
which a car could smash. Now does this mean that you are activating the symbol for 
"bank", or does it mean that you are setting some parameters in your symbol for "road 
Undoubtedly both. That is, the network of neurons which represents "road" has many 
different ways of firing, and you are selecting which subnetwork actually shall fire. At 
the same time, you are activating the symbol for "bank", and this is probably instrumental 
in the process of selecting the parameters for. "road", in that its neurons may send signals 
to some of those in "road"-and vice versa. (In case this seems a little confusing, it is 
because I am somewhat straddling levels of description-I am trying to set up an image of 
the symbols, as well as of their component neurons.) 

No less important than the nouns are the verbs, prepositions, etc: They, too, activate 
symbols, which send messages back and forth to each other. There are characteristic 
differences between the kinds of triggering patterns of symbols for verbs and symbols for 
nouns, of course, which means that they may be physically somewhat differently 
organized. For instance, nouns might have fairly localized symbols, while verbs and 
prepositions might have symbols with many "tentacles" reaching all around the cortex; or 
any number of other possibilities. 

After the story is all over, you learn it was all untrue. The power of 

Brains and Thoughts 


"rubbing off instances from classes, in the way that one makes rubbings from brasses in 
churches, has enabled you to represent the situation, and has freed you from the need to 
remain faithful to the real world. The fact that symbols can act as templates for other 
symbols gives you some mental independence of reality: you can create artificial 
universes, in which there can happen nonreal events with any amount of detail that you 
care to imbue them with. But the class symbols themselves, from which all of this 
richness springs, are deeply grounded in reality. 

Usually symbols play isomorphic roles to events which seem like they could happen, 
although sometimes symbols are activated which represent situations which could not 
happen-for example, watches sizzling, tubas laying eggs, etc. The borderline between 
what could and what could not happen is an extremely fuzzy one. As we imagine a 
hypothetical event, we bring certain symbols into active states-and depending on how 
well they interact (which is presumably reflected in our comfort in continuing the train of 
thought), we say the event "could" or "could not" happen. Thus the terms "could" and 
"could not" are extremely subjective. Actually, there is a good deal of agreement among 
people about which events could or could not happen. This reflects the great amount of 
mental structure which we all share-but there is a borderline area where the subjective 
aspect of what kinds of hypothetical worlds we are willing to entertain is apparent. A 
careful study of the kinds of imaginary events that people consider could and could not 
happen would yield much insight into the triggering patterns of the symbols by which 
people think. 

Intuitive Laws of Physics 

When the story has been completely told, you have built up quite an elaborate mental 
model of a scene, and in this model all the objects obey physical law. This means that 
physical law itself must be implicitly present in the triggering patterns of the symbols. Of 
course, the phrase "physical law" here does not mean "the laws of physics as expounded 
by a physicist", but rather the intuitive, chunked laws which all of us have to have in our 
minds in order to survive. 

A curious sidelight is that one can voluntarily manufacture mental sequences of events 
which violate physical law, if one so desires. For instance, if I but suggest that you 
imagine a scene with two cars approaching each other and then passing right through 
each other, you won't have any trouble doing so. The intuitive physical laws can be 
overridden by imaginary laws of physics; but how this overriding is done, how such 
sequences of images are manufactured-indeed what any one visual image is-all of these 
are deeply cloaked mysteries-inaccessible pieces of knowledge. 

Needless to say, we have in our brains chunked laws not only of how inanimate objects 
act, but also of how plants, animals, people and societies act-in other words, chunked 
laws of biology, psychology, sociology, and so 

Brains and Thoughts 


on. All of the internal representations of such entities involve the inevitable feature of 
chunked models: determinism is sacrificed for simplicity. Our representation of reality 
ends up being able only to predict probabilities of ending up in certain parts of abstract 
spaces of behavior-not to predict anything with the precision of physics. 

Procedural and Declarative Knowledge 

A distinction which is made in Artificial Intelligence is that between procedural and 
declarative types of knowledge. A piece of knowledge is said to be declarative if it is 
stored explicitly, so that not only the programmer but also the program can "read" it as if 
it were in an encyclopedia or an almanac. This usually means that it is encoded locally, 
not spread around. By contrast, procedural knowledge is not encoded as facts-only as 
programs. A programmer may be able to peer in and say, "I see that because of these 
procedures here, the program "knows' how to write English sentences"-but the program 
itself may have no explicit awareness of how it writes those sentences. For instance, its 
vocabulary may include none of the words "English", "sentence", and "write" at all! Thus 
procedural knowledge is usually spread around in pieces, and you can't retrieve it, or 
"key" on it. It is a global consequence of how the program works, not a local detail. In 
other words, a piece of purely procedural knowledge is an epiphenomenon. 

In most people there coexists, along with a powerful procedural representation of 
the grammar of their native language, a weaker declarative representation of it. The two 
may easily be in conflict, so that a native speaker will often instruct a foreigner to say 
things he himself would never say, but which agree with the declarative "book learning" 
he acquired in school sometime. The intuitive or chunked laws of physics and other 
disciplines mentioned earlier fall mainly on the procedural side; the knowledge that an 
octopus has eight tentacles falls mainly on the declarative side. 

In between the declarative and procedural extremes, there are all possible shades. 
Consider the recall of a melody. Is the melody stored in your brain, note by note? Could a 
surgeon extract a winding neural filament from your brain, then stretch it straight, and 
finally proceed to pinpoint along it the successively stored notes, almost as if it were a 
piece of magnetic tape? If so, then melodies are stored declaratively. Or is the recall of a 
melody mediated by the interaction of a large number of symbols, some of which 
represent tonal relationships, others of which represent emotional qualities, others of 
which represent rhythmic devices, and so on? If so, then melodies are stored 
procedurally. In reality, there is probably a mixture of these extremes in the way a 
melody is stored and recalled. 

It is interesting that, in pulling a melody out of memory, most people do not 
discriminate as to key, so that they are as likely to sing "Happy Birthday" in the key of F- 
sharp as in the key of C. This indicates that tone relationships, rather than absolute tones, 
are stored. But there is no reason 

Brains and Thoughts 


that tone relationships could not be stored quite declaratively. On the other hand, some 
melodies are very easy to memorize, whereas others are extremely elusive. If it were just 
a matter of storing successive notes, any melody could be stored as easily as any other. 
The fact that some melodies are catchy and others are not seems to indicate that the brain 
has a certain repertoire of familiar patterns which are activated as the melody is heard. 
So, to "play back" the melody, those patterns would have to be activated in the same 
order. This returns us to the concept of symbols triggering one another, rather than a 
simple linear sequence of declaratively stored notes or tone relationships. 

How does the brain know whether a piece of knowledge is stored declaratively? 
For instance, suppose you are asked, "What is the population of Chicago?" Somehow the 
number five million springs to mind, without your wondering, "Gee, how would I go 
about counting them all?" Now suppose I ask you, "How many chairs are there in your 
living room?" Here, the opposite happens-instead of trying to dredge the answer out of a 
mental almanac, you immediately either go to the room and count the chairs, or you 
manufacture the room in your head and count the chairs in the image of the room. The 
questions were of a single type-"how many?"-yet one of them caused a piece of 
declarative knowledge to be fetched, while the other one caused a procedural method of 
finding the answer to be invoked. This is one example where it is clear that you have 
knowledge about how you classify your own knowledge; and what is more, some of that 
metaknowledge may itself be stored procedurally, so that it is used without your even 
being aware of how it is done. 

Visual Imagery 

One of the most remarkable and difficult-to-describe qualities of consciousness is visual 
imagery. How do we create a visual image of our living room? Of a roaring mountain 
brook? Of an orange? Even more mysterious, how do we manufacture images 
unconsciously, images which guide our thoughts, giving them power and color and 
depth? From what store are they fetched? What magic allows us to mesh two or three 
images, hardly giving a thought as to how we should do it? Knowledge of how to do this 
is among the most procedural of all, for we have almost no insight into what mental 
imagery is. 

It may be that imagery is based on our ability to suppress motor activity. By this, I 
mean the following. If you imagine an orange, there may occur in your cortex a set of 
commands to pick it up, to smell it, to inspect it, and so on. Clearly these commands 
cannot be carried out, because the orange is not there. But they can be sent along the 
usual channels towards the cerebellum or other suborgans of the brain, until, at some 
critical point, a "mental faucet" is closed, preventing them from actually being carried 
out. Depending on how far down the line this "faucet" is situated, the images may be 
more or less vivid and real-seeming. Anger can cause us to 

Brains and Thoughts 


imagine quite vividly picking up some object and throwing it, or kicking something; yet 
we don't actually do so. On the other hand, we feel so "near" to actually doing so. 
Probably the faucet catches the nerve impulses "at the last moment". 

Here is another way in which visualization points out the distinction between 
accessible and inaccessible knowledge. Consider how you visualized the scene of the car 
skidding on the mountain road. Undoubtedly you imagined the mountain as being much 
larger than the car. Now did this happen because sometime long ago you had occasion to 
note that "cars are not as big as mountains"; then you committed this statement to rote 
memory: and in imagining the story, you retrieved this fact, and made use of it in 
constructing your image? A most unlikely theory. Or did it happen instead as a 
consequence of some introspectively inaccessible interactions of the symbols which were 
activated in your brain? Obviously the latter seems far more likely. This knowledge that 
cars are smaller than mountains is not a piece of rote memorization, but a piece of 
knowledge which can be created by deduction. Therefore, most likely it is not stored in 
any single symbol in your brain, but rather it can be produced as a result of the activation, 
followed by the mutual interaction, of many symbols-for example, those for "compare", 
"size", "car", "mountain", and probably, others. This means that the knowledge is stored 
not explicitly, but implicitly, in a spread-about manner, rather than as a local "packet of 
information". Such simple facts as relative sizes of objects have to be assembled, rather 
than merely retrieved. Therefore, even in the case of a verbally accessible piece of 
knowledge, there are complex inaccessible processes which mediate its coming to the 
state of being ready to be said. 

We shall continue our exploration of the entities called "symbols" in different 
Chapters. In Chapters XVIII and XIX, on Artificial Intelligence, we shall discuss some 
possible ways of implementing active symbols in programs. And next Chapter, we shall 
discuss some of the insights that our symbol-based model of brain activity give into the 
comparison of brains. 

Brains and Thoughts 


English French German Suite 

By Lewis Carroll . 

... et Frank L. Warrin 

. and Robert Scott 

'Twas brillig, and the slithy toves 
Did gyre and gimble in the wabe: 
All mimsy were the borogoves, 
And the mome raths outgrabe. 

II brilgue: les toves lubricilleux 
Se gyrent en vrillant dans le guave. 
Enmimes sont les gougebosqueux 
Et le momerade horsgrave. 

Es brillig war. Die schlichten Toven 
Wirrten and wimmelten in Waben; 
Und aller-mumsige Burggoven 
Die mohmen Rath' ausgraben. 

"Beware the Jabberwock, my son! 
The jaws that bite, the claws that catch! 
Beware the Jubjub bird, and shun 
The frumious Bandersnatch!" 

((Garde -toi du Jaseroque, mon fits! 
La gueule qui mord; la griffe qui prend! 
Garde-toi de I'oiseau Jube, evite 
Le frumieux Band-a-prend!)) 

))Bewahre doch vor Jammerwoch! 
Die Zahne knirschen, Krallen kratzen! 
Bewahr' vor Jubjub-Vogel, vor 
Frumiosen Banderschnatzchen!)), 

He took his vorpal sword in hand: 
Long time the manxome foe he sought 
So rested he by the Tumtum tree, 
And stood awhile in thought. 

Son glaive vorpal en main, it va 
T-a la recherche du fauve manscant; 
Puis arrive a I'arbre Te-te, 
1 y reste, reflechissant 

English French German Suite 


Er griff sein vorpals Schwertchen zu, 
Er suchte lang das manchsam' Ding; 
Dann, stehend unterm Tumtum Baum, 
Er an-zu-denken-fing. 

And, as in uffish thought he stood, 
The Jabberwock, with eyes of flame. 
Came whiffling through the tulgey wood, 
And burbled as it came! 

Pendant qu'il pense, tout uffuse, 
Le Jaseroque, a l'oeil flambant, 
Vient siblant par le bois tullegeais, 
Et burbule en venant. 

Als stand er tief in Andacht auf, 
Des Jammerwochen's Augen-feuer 
Durch turgen Wald mit Wiffek kam 
Fin burbelnd Ungeheuer! 

One, two! One, two! And through and through 
The vorpal blade went snicker-snack! 
He left it dead, and with its head 
He went galumphing back. 

Un deux, un deux, par le milieu, 
Le glaive vorpal fait pat-a-pan! 
La bete defaite, avec sa tete, 
II rentre gallomphant. 

Eins, Zwei! Eins, Zwei! Und durch and durch 
Sein vorpals Schwert zerschnifer-schnuck, 
Da blieb es todt! Er, Kopf in Hand, 
Gelaumfig zog zuriick. 

"And hast thou slain the Jabberwock? 
Come to my arms, my beamish boy! 
0 frabjous day! Callooh! Callay!" 
He chortled in his joy. 

((As-tu tue le Jaseroque? 
Viens a mon coeur, fils rayonnais! 
O jour frabbejais! Calleau! Callai!)) 
II cortule clans sa joie. 

))Und schlugst Du ja den Jammerwoch? 
Umarme mich, mein Bohm'sches Kind! 
O Freuden-Tag! 0 Halloo-Schlag!(( 
Er schortelt froh-gesinnt. 

English French German Suite 

'Twas brillig, and the slithy toves 
Did gyre and gimble in the wabe: 
All mimsy were the borogoves, 
And the mome raths outgrabe. 

II brilgue: les toves lubricilleux 
Se gyrent en vrillant dans le guave. 
Enmimes sont les gougebosqueux 
Et le momerade horsgrave. 

Es brillig war. Die schlichten Toven 
Wirrten and wimmelten in Waben: 
Und aller-mumsige Burggoven 
Die mohmen Rath' ausgraben. 

English French German Suite 



Minds and Thoughts 

Can Minds Be Mapped onto Each Other? 

Now THAT WE have hypothesized the existence of very high-level active 
subsystems of the brain (symbols), we may return to the matter of a possible 
isomorphism, or partial isomorphism, between two brains. Instead of asking about an 
isomorphism on the neural level (which surely does not exist), or on the macroscopic 
suborgan level (which surely does exist but does not tell us very much), we ask about the 
possibility of an isomorphism between brains on the symbol level: a correspondence 
which not only maps symbols in one brain onto symbols in another brain, but also maps 
triggering patterns onto triggering patterns. This means that corresponding symbols in the 
two brains are linked in corresponding ways. This would be a true functional 
isomorphism-the same type of isomorphism as we spoke of when trying to characterize 
what it is that is invariant about all butterflies, 

It is clear from the outset that such an isomorphism does not exist between any 
pair of human beings. If it did, they would be completely indistinguishable in their 
thoughts; but in order for that to be true, they would have to have completely 
indistinguishable memories, which would mean they would have to have led one and the 
same life. Even identical twins do not approach, in the remotest degree, this ideal. 

How about a single individual% When you look back over things which you 
yourself wrote a few years ago, you think "How awful!" and smile with amusement at the 
person you once were. What is worse is when you do the same thing with something you 
wrote or said five minutes ago. When this happens, it shows that you do not fully 
understand the person you were moments ago. The isomorphism from your brain now to 
your brain then is imperfect. What, then, of the isomorphisms to other people, other 
species ... 

The opposite side of the coin is shown by the power of the communication that 
arises between the unlikeliest partners. Think of the barriers spanned when you read lines 
of poetry penned in jail by Francois Villon, the French poet of the 1400's. Another human 
being, in another era, captive in jail, speaking another language ... How can you ever 
hope to have a sense of the connotations behind the facade of his words, translated into 
English% Yet a wealth of meaning comes through. 

Thus, on the one hand, we can drop all hopes of finding exactly isomorphic 
software in humans, but on the other, it is clear that some people think more alike than 
others do. It would seem an obvious conclu 

Minds and Thoughts 


Minds and Thoughts 


sion that there is some sort of partial software isomorphism connecting the brains of 
people wbose style of thinking is similar-in particular, a correspondence of (1) the 
repertoire of symbols, and (2) the triggering patterns of symbols 

Comparing Different Semantic Networks 

But what is a partial isomorphism? This is a most difficult question to answer. It is made 
even more difficult by the fact that no one has found an adequate way to represent the 
network of symbols and their triggering patterns. Sometimes a picture of a small part of 
such a network of symbols is drawn, where each symbol is represented as a node into 
which, and out of which, lead some arcs. The lines represent triggering relationships-in 
some sense. Such figures attempt to capture something of the intuitively sensible notion 
of "conceptual nearness". However, there are many different kinds of nearness, and 
different ones are relevant in different contexts. A tiny portion of my own "semantic 
network" is shown in Figure 70. The problem is that representing a complex 
interdependency of many symbols cannot be carried out very easily with just a few lines 
joining vertices. 

Another problem with such a diagram is that it is not accurate to think of a symbol 
as simply "on" or "off. While this is true of neurons, it does not carry upwards, to 
collections of them. In this respect, symbols are quite a bit more complicated than 
neurons-as you might expect, since they are made up of many neurons. The messages that 
are exchanged between symbols are more complex than the mere fact, "I am now 
activated". That is more like the neuron-level messages. Each symbol can be activated in 
many different ways, and the type of activation will be influential in determining which 
other symbols it tries to activate. How these intertwining triggering relationships can be 
represented in a pictorial manner-indeed, whether they can be at all-is not clear. 

But for the moment, suppose that issue had been solved. Suppose we now agree 
that there are certain drawings of nodes, connected by links (let us say they come in 
various colors, so that various types of conceptual nearness can be distinguished from 
each other), which capture precisely the way in which symbols trigger other symbols. 
Then under what conditions would we feel that two such drawings were isomorphic, or 
nearly isomorphic? Since we are dealing with a visual representation of the network of 
symbols, let us consider an analogous visual problem. How would you try to determine 
whether two spiderwebs had been spun by spiders belonging to the same species? Would 
you try to identify individual vertices which correspond exactly, thereby setting up an 
exact map of one web onto the other, vertex by vertex, fiber by fiber, perhaps even angle 
by angle? This would be a futile effort. Two webs are never exactly the same: yet there is 
still some sort of "style", "form", what-have-you, that infallibly brands a given species' 

In any network-like structure, such as a spiderweb, one can look at local 
properties and global properties. Local properties require only a very 

Minds and Thoughts 


nearsighted observer- for example an observer who can only see one vertex at a time; and 
global properties require only a sweeping vision, without attention to detail. Thus, the 
overall shape of a spiderweb is a global property, whereas the average number of lines 
meeting at a vertex is a local property. Suppose we agree that the most reasonable 
criterion for calling two spiderwebs "isomorphic" is that they should have been spun by 
spiders of the same species. Then it is interesting to ask which kind of observation-local 
or global-tends to be a more reliable guide in determining whether two spiderwebs are 
isomorphic. Without answering the question for spiderwebs, let us now return to the 
question of the closeness-or isomorphicness, if you will-of two symbol networks. 

Translations of " Jabberwocky" 

Imagine native speakers of English, French, and German, all of whom have excellent 
command of their respective native languages, and all of whom enjoy wordplay in their 
own language. Would their symbol networks be similar on a local level, or on a global 
level? Or is it meaningful to ask such a question? The question becomes concrete when 
you look at the preceding translations of Lewis Carroll's famous "Jabberwocky". 

I chose this example because it demonstrates, perhaps better than an example in 
ordinary prose, the problem of trying to find "the same node" in two different networks 
which are, on some level of analysis, extremely nonisomorphic. In ordinary language, the 
task of translation is more straightforward, since to each word or phrase in the original 
language, there can usually be found a corresponding word or phrase in the new 
language. By contrast, in a poem of this type, many "words" do not carry ordinary 
meaning, but act purely as exciters of nearby symbols. However, what is nearby in one 
language may be remote in another. 

Thus, in the brain of a native speaker of English, "slithy" probably activates such 
symbols as "slimy", "slither", "slippery", "lithe", and "sly", to varying extents. Does 
"lubricilleux" do the corresponding thing in the brain of a Frenchman? What indeed 
would be "the corresponding thing"? Would it be to activate symbols which are the 
ordinary translations of those words? What if there is no word, real or fabricated, which 
will accomplish that? Or what if a word does exist, but is very intellectual-sounding and 
Latinate ("lubricilleux"), rather than earthy and Anglo-Saxon ("slithy")? Perhaps 
"huilasse" would be better than "lubricilleux"? Or does the Latin origin of the word 
"lubricilleux" not make itself felt to a speaker of French in the way that it would if it were 
an English word ("lubricilious", perhaps)? 

An interesting feature of the translation into French is the transposition into the 
present tense. To keep it in the past would make some unnatural turns of phrase 
necessary, and the present tense has a much fresher flavor in French than the past. The 
translator sensed that this would be "more appropriate" -in some ill-defined yet 
compelling senseand made the switch. Who can say whether remaining faithful to the 
English tense would have been better? 

Minds and Thoughts 


In the German version, the droll phrase "er an-zu-denken-fing" occurs; it does not 
correspond to any English original. It is a playful reversal of words, whose flavor vaguely 
resembles that of the English phrase "he out-to-ponder set", if I may hazard a reverse 
translation. Most likely this funny turnabout of words was inspired by the similar playful 
reversal in the English of one line earlier: "So rested he by the Tumtum tree". It 
corresponds, yet doesn't correspond. 

Incidentally, why did the Tumturn tree get changed into an "arbre T6-t6" in 
French? Figure it out for yourself. 

The word "manxome" in the original, whose "x" imbues it with many rich 
overtones, is weakly rendered in German by "manchsam", which hack-translates into 
English as "maniful". The French "manscant" also lacks the manifold overtones of 
"manxome". There is no end to the interest of this kind of translation task. 

When confronted with such an example, one realizes that it is utterly impossible 
to make an exact translation. Yet even in this pathologically difficult case of translation, 
there seems to be some rough equivalence obtainable. Why is this so, if there really is no 
isomorphism between the brains of people who will read the different versions? The 
answer is that there is a kind of rough isomorphism, partly global, partly local, between 
the brains of all the readers of these three poems. 


An amusing geographical fantasy will give some intuition for this kind of quasi- 
isomorphism. (Incidentally, this fantasy is somewhat similar to a geographical analogy 
devised by M. Minsky in his article on "frames", which can be found in P. H. Winston's 
book The Psychology of Computer Vision.) Imagine that you are given a strange atlas of 
the USA, with all natural geological features premarked-such as rivers, mountains, lakes, 
and so on-but with nary a printed word. Rivers are shown as blue lines, mountains b 
color, and so on. Now you are told to convert it into a road atlas for a trip which you will 
soon make. You must neatly fill in the names of all states, their boundaries, time zones, 
then all counties, cities, towns, all freeways and highways and toll routes, all county 
roads, all state and national parks, campgrounds, scenic areas, dams, airports, and so on 
... All of this must be carried out down to the level that would appear in a detailed road 
atlas. And it must be manufactured out of your own head. You are not allowed access to 
any information which would help you for the duration of your task. 

You are told that it will pay off, in ways that will become clear at a later date, to 
make your map as true as you can. Of course, you will begin by filling in large cities and 
major roads, etc., which you know. And when you have exhausted your factual 
knowledge of an area, it will be to your advantage to use your imagination to help you 
reproduce at least the flavor of that area, if not its true geography, by making up fake 
town names, fake populations, fake roads, fake parks, and so on. This arduous task will 

Minds and Thoughts 


months. To make things a little easier, you have a cartographer on hand to print 
everything in neatly. The end product will be your personal map of the "Alternative 
Structure of the Union"-your own personal "ASU". 

Your personal ASU will be very much like the USA in the area where you grew 
up. Furthermore, wherever your travels have chanced to lead you, or wherever you have 
perused maps with interest, your ASU will have spots of striking agreement with the 
USA: a few small towns in North Dakota or Montana, perhaps, or the whole of 
metropolitan New York, might be quite faithfully reproduced in your ASU. 

A Surprise Reversal 

When your ASU is done, a surprise takes place. Magically, the country you have 
designed comes into being, and you are transported there. A friendly committee presents 
you with your favorite kind of-automobile, and explains that, "As a reward for your 
designing efforts, you may now enjoy an all-expense-paid trip, at a leisurely pace, around 
the good old A. S. of U. You may go wherever you want, do whatever you wish to do, 
taking as long as you wish-compliments of the Geographical Society of the ASU. And-to 
guide you around-here is a road atlas." To your surprise, you are given not the atlas 
which you designed, but a regular road atlas of the USA. 

When you embark on your trip, all sorts of curious incidents will take place. A 
road atlas is being used to guide you through a country which it only partially fits. As 
long as you stick to major freeways, you will probably be able to cross the country 
without gross confusions. But the moment you wander off into the byways of New 
Mexico or rural Arkansas, there will be adventure in store for you. The locals will not 
recognize any of the towns you're looking for, nor will they know the roads you're asking 
about. They will only know the large cities you name, and even then the routes to those 
cities will not be the same as are indicated on your map. It will happen occasionally that 
some of the cities which are considered huge by the locals are nonexistent on your map of 
the USA; or perhaps they exist, but their population according to the atlas is wrong by an 
order of magnitude. 

Centrality and Universality 

What makes an ASU and the USA, which are so different in some ways, nevertheless so 
similar? It is that their most important cities and routes of communication can be mapped 
onto each other. The differences between them are found in the less frequently traveled 
routes, the cities of smaller size, and so on. Notice that this cannot be characterized either 
as a local or a global isomorphism. Some correspondences do extend down to the very 
local level-for instance, in both New Yorks, the main street may be Fifth Avenue, and 
there may be a Times Square in both as well-yet there may not be a single town that is 
found in both Montanas. So the local-global 

Minds and Thoughts 


distinction is not relevant here. What is relevant is the centrality of the city, in terms of 
economics, communication, transportation, etc. The more vital the city is, in one of these 
ways, the more certain it will be to occur in both the ASU and the USA. 

In this geographic analogy, one aspect is very crucial: that there are certain 
definite, absolute points of reference which will occur in nearly all ASU's: New York, 
San Francisco, Chicago, and so on. From these it is then possible to orient oneself. In 
other words, if we begin comparing my ASU with yours, I can use the known agreement 
on big cities to establish points of reference with which I can communicate the location 
of smaller cities in my ASU. And if I hypothesize a voyage from Kankakee to Fruto and 
you don't know where those towns are, I can refer to something we have in common, and 
thereby guide you. And if I talk about a voyage from Atlanta to Milwaukee, it may go 
along different freeways or smaller roads, but the voyage itself can still be carried out in 
both countries. And if you start describing a trip from Horsemilk to Janzo, I can plot out 
what seems to me to be an analogous trip in my ASU, despite not having towns by those 
names, as long as you constantly keep me oriented by describing your position with 
respect to nearby larger towns which are found in my ASU as well as in yours. 

My roads will not be exactly the same as yours, but, with our separate maps, we 
can each get from a particular part of the country to another. We can do this, thanks to the 
external, predetermined geological facts mountain chains, streams, etc. -facts which were 
available to us both as we worked on our maps. Without those external features, we 
would have no possibility of reference points in common. For instance, if you had been 
given only a map of France, and I had been given a map of Germany, and then we had 
both filled them in in great detail, there would he no way to try to find "the same place" 
in our fictitious lands. It is necessary to begin with identical external conditions- 
otherwise nothing will match. 

Now that we have carried our geographical analogy quite far, we return to the 
question of isomorphisms between brains. You might well wonder why this whole 
question of brain isomorphisms has been stressed so much. What does it matter if two 
brains are isomorphic, or quasi-isomorphic, or not isomorphic at all? The answer is that 
we have an intuitive sense that, although other people differ from us in important ways, 
they are still "the same" as we are in some deep and important ways. It would be 
instructive to be able to pinpoint what this invariant core of human intelligence is, and 
then to be able to describe the kinds of "embellishments" which can be added to it, 
making each one of us a unique embodiment of this abstract and mysterious quality 
called "intelligence". 

In our geographic analogy, cities and towns were the analogues of symbols, while 
roads and highways were analogous to potential triggering paths. The fact that all ASU's 
have some things in common, such as the East Coast, the West Coast, the Mississippi 
River, the Great Lakes, the Rockies, and many major cities and roads is analogous to the 
fact that we are all forced, by external realities, to construct certain class symbols and 

Minds and Thoughts 


ing paths in the same way. These core symbols are like the large cities, to which everyone 
can make reference without ambiguity. (Incidentally, the fact that cities are localized 
entities should in no way be taken as indicative that symbols in a brain are small, almost 
point-like entities. They are merely symbolized in that manner in a network.) 

The fact is that a large proportion of every human's network of symbols is 
universal. We simply take what is common to all of us so much for granted that it is hard 
to see how much we have in common with other people. It takes the conscious effort of 
imagining how much-or how little-we have in common with other types of entities, such 
as stones, cars, restaurants, ants, and so forth, to make evident the large amount of 
overlap that we have with randomly chosen people. What we notice about another person 
immediately is not the standard overlap, because that is taken for granted as soon as we 
recognize the humanity of the other person; rather, we look beyond the standard overlap 
and generally find some major differences, as well as some unexpected, additional 

Occasionally, you find that another person is missing some of what you thought 
was the standard, minimal core-as if Chicago were missing from their ASU, which is 
almost unimaginable. For instance, someone might not know what an elephant is, or who 
is President, or that the earth is round. In such cases, their symbolic network is likely to 
be so fundamentally different from your own that significant communication will be 
difficult. On the other hand, perhaps this same person will share some specialized kind of 
knowledge with you-such as expertise in the game of dominoes-so that you can 
communicate well in a limited domain. This would be like meeting someone who comes 
from the very same rural area of North Dakota as you do, so that your two ASU's 
coincide in great detail over a very small region, which allows you to describe how to get 
from one place to another very fluently. 

How Much Do Language and Culture Channel Thought? 

If we now go back to comparing our own symbol network with those of a Frenchman and 
a German, we can say that we expect them to have the standard core of class symbols, 
despite the fact of different native languages. We do not expect to share highly 
specialized networks with them, but we do not expect such sharing with a randomly 
chosen person who shares our native language, either. The triggering patterns of people 
with other languages will be somewhat different from our own, but still the major class 
symbols, and the major routes between them, will be universally available, so that more 
minor routes can be described with reference to them. 

Now each of our three people may in addition have some command of the 
languages of the other two. What is it that marks the difference between true fluency, and 
a mere ability to communicate? First of all, someone fluent in English uses most words at 
roughly their- regular frequencies. A non-native speaker will have picked up some words 

Minds and Thoughts 


dictionaries, novels, or classes-words which at some time may have been prevalent or 
preferable, but which are now far down in frequency-for example, "fetch" instead of 
"get", "quite" instead of "very", etc. Though the meaning usually comes through, there is 
an alien quality transmitted by the unusual choice of words. 

But suppose that a foreigner learns to use all words at roughly the normal 
frequencies. Will that make his speech truly fluent? Probably not. Higher than the word 
level, there is an association level, which is attached to the culture as a whole-its history, 
geography, religion, children's stories, literature, technological level, and so on. For 
instance, to be able to speak modern Hebrew absolutely fluently, you need to know the 
Bible quite well in Hebrew, because the language draws on a stock of biblical phrases 
and their connotations. Such an association level permeates each language very deeply. 
Yet there is room for all sorts of variety inside fluency-otherwise the only truly fluent 
speakers would be people whose thoughts were the most stereotyped possible! 

Although we should recognize the depth to which culture affects thought, we 
should not overstress the role of language in molding thoughts. For instance, what we 
might call two "chairs" might be perceived by a speaker of French as objects belonging to 
two distinct types: "chaise" and "fauteuil" ("chair" and "armchair"). People whose native 
language is French are more aware of that difference than we are-but then people who 
grow up in a rural area are more aware of, say, the difference between a pickup and a 
truck, than a city dweller is. A city dweller may call them both "trucks". It is not the 
difference in native language, but the difference in culture (or subculture), that gives rise 
to this perceptual difference. 

The relationships between the symbols of people with different native languages 
have every reason to be quite similar, as far as the core is concerned, because everyone 
lives in the same world. When you come down to more detailed aspects of the triggering 
patterns, you will find that there is less in common. It would he like comparing rural 
areas in Wisconsin in ASU's which had been made up by people who had never lived in 
Wisconsin. This will be quite irrelevant, however, as long as there is sufficient agreement 
on the major cities and major routes, so that there are common points of reference all 
over the map. 

Trips and Itineraries in ASU's 

Without making it explicit, I have been using an image of what a "thought" is in the 
ASU-analogy-namely, I have been implying that a thought corresponds to a trip. The 
towns which are passed through represent the symbols which are excited. This is not a 
perfect analogy, but it is quite strong. One problem with it is that when a thought recurs 
in someone's mind sufficiently often, it can get chunked into a single concept. This would 
correspond to quite a strange event in an ASU: a commonly taken trip would become, in 
some strange fashion, a new town or city! If one is to continue to use the ASU-metaphor, 
then, it is important to remember that 

Minds and Thoughts 


the cities represent not only the elementary symbols, such as those for "grass", "house", 
and "car", but also symbols which get created as a result of the chunking ability of a 
brain-symbols for such sophisticated concepts as "crab canon", "palindrome", or "ASU". 

Now if it is granted that the notion of taking a trip is a fair counterpart to the 
notion of having a thought, then the following difficult issue comes up: virtually any 
route leading from one city to a second, then to a third, and so on, can be imagined, as 
long as one remembers that some intervening cities are also passed through. This would 
correspond to the activation of an arbitrary sequence of symbols, one after another, 
making allowance for some extra symbols-those which lie en route. Now if virtually any 
sequence of symbols can be activated in any desired order, it may seem that a brain is an 
indiscriminate system, which can absorb or produce any thought whatsoever. But we all 
know that that is not so. In fact, there are certain kinds of thoughts which we call 
knowledge, or beliefs, which play quite a different role from random fancies, or 
humorously entertained absurdities. How can we characterize the difference between 
dreams, passing thoughts, beliefs, and pieces of knowledge? 

Possible, Potential, and Preposterous Pathways 

There are some pathways-you can think of them as pathways either in an ASU or in a 
brain-which are taken routinely in going from one place to another. There are other 
pathways which can only be followed if one is led through them by the hand. These 
pathways are "potential pathways", which would be followed only if special external 
circumstances arose. The pathways which one relies on over and over again are pathways 
which incorporate knowledge-and here I mean not only knowledge of facts (declarative 
knowledge), but also knowledge of how-to's (procedural knowledge). These stable, 
reliable pathways are what constitute knowledge. Pieces of knowledge merge gradually 
with beliefs, which are also represented by reliable pathways, but perhaps ones which are 
more susceptible to replacement if, so to speak, a bridge goes out, or there is heavy fog. 
This leaves us with fancies, lies, falsities, absurdities, and other variants. These would 
correspond to peculiar routes such as: New York City to Newark via Bangor, Maine and 
Lubbock, Texas. They are indeed possible pathways, but ones which are not likely to be 
stock routes, used in everyday voyages. 

A curious, and amusing, implication of this model is that all of the "aberrant" 
kinds of thoughts listed above are composed, at rock bottom, completely out of beliefs or 
pieces of knowledge. That is, any weird and snaky indirect route breaks up into a number 
of non-weird, non-snaky direct stretches, and these short, straightforward symbol- 
connecting routes represent simple thoughts that one can rely on-beliefs and pieces of 
knowledge. On reflection, this is hardly surprising, however, since it is quite reasonable 
that we should only be able to imagine fictitious things that are somehow grounded in the 
realities we have experienced, no matter how 

Minds and Thoughts 


wildly they deviate from them. Dreams are perhaps just such random meanderings about 
the ASU's of our minds. Locally, they make sense-but globally ... 

Different Styles of Translating Novels 

A poem like 'Jabberwocky" is like an unreal journey around an ASU, hopping from one 
state to another very quickly, following very curious routes. The translations convey this 
aspect of the poem, rather than the precise sequence of symbols which are triggered, 
although they do their best in that respect. In ordinary prose, such leaps and bounds are 
not so common. However, similar problems of translation do occur. Suppose you are 
translating a novel from Russian to English, and come across a sentence whose literal 
translation is, "She had a bowl of borscht." Now perhaps many of your readers will have 
no idea what borscht is. You could attempt to replace it by the "corresponding" item in 
their culture-thus, your translation might run, "She had a bowl of Campbell's soup." Now 
if you think this is a silly exaggeration, take a look at the first sentence of Dostoevsky's 
novel Crime and Punishment in Russian and then in a few different English translations. I 
happened to look at three different English paperback translations, and found the 
following curious situation. 

The first sentence employs the street name "S. Pereulok" (as transliterated). What 
is the meaning of this? A careful reader of Dostoevsky's work who knows Leningrad 
(which used to be called "St. Petersburg" -or should I say "Petrograd"?) can discover by 
doing some careful checking of the rest of the geography in the book (which incidentally 
is also given only by its initials) that the street must be "Stoliarny Pereulok". Dostoevsky 
probably wished to tell his story in a realistic way, yet not so realistically that people 
would take literally the addresses at which crimes and other events were supposed to 
have occurred. In any case, we have a translation problem; or to be more precise, we have 
several translation problems, on several different levels. 

First of all, should we keep the initial so as to reproduce the aura of semi-mystery 
which appears already in this first sentence of the book? We would get "S. Lane" ("lane" 
being the standard translation of "pereulok"). None of the three translators took this tack. 
However, one chose to write "S. Place". The translation of Crime and Punishment which 
I read in high school took a similar option. I will never forget the disoriented feeling I 
experienced when I began reading the novel and encountered those streets with only 
letters for names. I had some sort of intangible malaise about the beginning of the book; I 
was sure that I was missing something essential, and yet I didn't know what it was ... I 
decided that all Russian novels were very weird. 

Now we could be frank with the reader (who, it may be assumed, probably won't 
have the slightest idea whether the street is real or fictitious anyway!) and give him the 
advantage of our modern scholarship, writing 

Minds and Thoughts 


"Stoliarny Lane" (or "Place"). This was the choice of translator number 2, who gave the 
translation as "Stoliarny Place". 

What about number 3? This is the most interesting of all. This translation says 
"Carpenter's Lane". And why not, indeed? After all, "stoliar" means "carpenter" and "ny" 
is an adjectival ending. So now we might imagine ourselves in London, not Petrograd, 
and in the midst of a situation invented by Dickens, not Dostoevsky. Is that what we 
want-, Perhaps we should just read a novel by Dickens instead, with the justification that 
it is "the corresponding work in English". When viewed on a sufficiently high level, it is 
a "translation" of the Dostoevsky novel-in fact, the best possible one! Who needs 

We have come all the way from attempts at great literal fidelity to the author's 
style, to high-level translations of flavor. Now if this happens already in the first 
sentence, can you imagine how it must go on in the rest of the book? What about the 
point where a German landlady begins shouting in her German-style Russian% How do 
you translate broken Russian spoken with a German accent, into English? 

Then one may also consider the problems of how to translate slang and colloquial 
modes of expression. Should one search for an "analogous" phrase, or should one settle 
for a word-by-word translation? If you search for an analogous phrase, then you run the 
risk of committing a "Campbell's soup" type of blunder; but if you translate every 
idiomatic phrase word by word, then the English will sound alien. Perhaps this is 
desirable, since the Russian culture is an alien one to speakers of English. But a speaker 
of English who reads such a translation will constantly be experiencing, thanks to the 
unusual turns of phrase, a sense-an artificial sense-of strangeness, which was not intended 
by the author, and which is not experienced by readers of the Russian original. 

Problems such as these give one pause in considering such statements as this one, 
made by Warren Weaver, one of the first advocates of translation by computer, in the late 
1940's: "When I look at an article in Russian, I say, 'This is really written in English, but 
it has been coded in some strange symbols. I will now proceed to decode."" Weaver's 
remark simply cannot be taken literally; it must rather be considered a provocative way of 
saying that there is an objectively describable meaning hidden in the symbols, or at least 
something pretty close to objective; therefore, there would be no reason to suppose a 
computer could not ferret it out, if sufficiently well programmed. 

High-Level Comparisons between Programs 

Weaver's statement is about translations between different natural languages. Let's 
consider now the problem of translating between two computer languages. For instance, 
suppose two people have written programs which run on different computers, and we 
want to know if the two programs carry out the same task. How can we find out? We 
must compare the programs. But on what level should this be done? Perhaps one program 

Minds and Thoughts 


mer wrote in a machine language, the other in a compiler language. Are two such 
programs comparable? Certainly. But how to compare them? One way might be to 
compile the compiler language program, producing a program in the machine language of 
its home computer. 

Now we have two machine language programs. But there is another problem: 
there are two computers, hence two different machine languages-and they may be 
extremely different. One machine may have sixteen-bit words; the other thirty-six-bit 
words. One machine may' have built-in stack-handling instructions (pushing and 
popping), while the other lacks them. The differences between the hardware of the two 
machines may make the two machine language programs seem incomparable-and yet we 
suspect they are performing the same task, and we would like to see that at a glance. We 
are obviously looking at the programs from much too close a distance. 

What we need to do is to step back, away from machine language, towards a 
higher, more chunked view. From this vantage point, we hope we will be able to perceive 
chunks of program which make each program seem rationally planned out on a global, 
rather than a local, scale-that is, chunks which fit together in a way that allows one to 
perceive the goals of the programmer. Let us assume that both programs were originally 
written in high-level languages. Then some chunking has already been done for us. But 
we will run into other troubles. There is a proliferation of such languages: Fortran, Algol, 
LISP, APL, and many others. How can you compare a program written in APL with one 
written in Algol: Certainly not by matching them up line by line. You will again chunk 
these programs in your mind, looking for conceptual, functional units which correspond. 
Thus, you are not comparing hardware, you are not comparing software-you are 
comparing "etherware"-the pure concepts which lie back of the software. There is some 
sort of abstract "conceptual skeleton" which must be lifted out of low levels before you 
can carry out a meaningful comparison of two programs in different computer languges, 
of two animals, or of two sentences in different natural languages. 

Now this brings us back to an earlier question which we asked about computers 
and brains: How can we make sense of a low-level description of a computer or a brain? 
Is there, in any reasonable sense, an objective way to pull a high-level description out of a 
low-level one, in such complicated systems? In the case of a computer, a full display of 
the contents of memory-a so-called memory dump-is easily available. Dumps were 
commonly printed out in the early days of computing, when something went wrong with 
a program. Then the programmer would have to go home and pore over the memory 
dump for hours, trying to understand what each minuscule piece of memory represented. 
In essence, the programmer would be doing the opposite of what a compiler does: he 
would be translating from machine language into a higher-level language, a conceptual 
language. In the end, the programmer would understand the goals of the program and 
could describe it in high-level terms-for example, "This program translates novels front 
Russian to English", or "This program composes an eight- voice fugue based on any 
theme which is fed in". 

Minds and Thoughts 


High-Level Comparisons between Brains 

Now our question must be investigated in the case of brains. In this case, we are asking, 
"Are people's brains also capable of being 'read', on a high level? Is there some objective 
description of the content of a brain?" In the Ant Fugue, the Anteater claimed to be able 
to tell what Aunt Hillary was thinking about, by looking at the scurryings of her 
component ants. Could some superbeing-a Neuroneater, perhaps-conceivably look down 
on our neurons, chunk what it sees, and come up with an analysis of our thoughts? 

Certainly the answer must be yes, since we are all quite able to describe, in 
chunked (i.e., non-neural) terms, the activity of our minds at any given time. This means 
that we have a mechanism which allows us to chunk our own brain state to some rough 
degree, and to give a functional description of it. To be more precise, we do not chunk all 
of the brain state-we only chunk those portions of it which are active. However, if 
someone asks us about a subject which is coded in a currently inactive area of our brain, 
we can almost instantly gain access to the appropriate dormant area and come up with a 
chunked description of it-that is, some belief on that subject. Note that we come back 
with absolutely zero information on the neural level of that part of the brain: our 
description is so chunked that we don't even have any idea what part of our brain it is a 
description of. This can be contrasted with the programmer whose chunked description 
comes from conscious analysis of every part of the memory dump. 

Now if a person can provide a chunked description of any part of his own brain, 
why shouldn't an outsider too, given some nondestructive means of access to the same 
brain, not only be able to chunk limited portions of the brain, but actually to give a 
complete chunked description of it-in other words, a complete documentation of the 
beliefs of the person whose brain is accessible? It is obvious that such a description 
would have an astronomical size, but that is not of concern here. We are interested in the 
question of whether, in principle, there exists a well-defined, highlevel description of a 
brain, or whether, conversely, the neuron-level description-or something equally 
physiological and intuitively unenlightening-is the best description that in principle 
exists. Surely, to answer this question would be of the highest importance if we seek to 
know whether we can ever understand ourselves. 

Potential Beliefs, Potential Symbols 

It is my contention that a chunked description is possible, but when we get it, all will not 
suddenly be clear and light. The problem is that in order to pull a chunked description out 
of the brain state, we need a language to describe our findings. Now the most appropriate 
way to describe a brain, it would seem, would be to enumerate the kinds of thoughts it 
could entertain, and the kinds of thoughts it could not entertain-or, perhaps, to enumerate 
its beliefs and the things which it does not believe. If that is the 

Minds and Thoughts 


kind of goal we will be striving for in a chunked description, then it is easy to see what 
kinds of troubles we will run up against. 

Suppose you wanted to enumerate all possible voyages that could be taken in an 
ASU; there are infinitely many. How do you determine which ones are plausible, though? 
Well, what does "plausible" mean? We will have precisely this kind of difficulty in trying 
to establish what a "possible pathway" from symbol to symbol in a brain is. We can 
imagine an upsidedown dog flying through the air with a cigar in its mouth-or a collision 
between two giant fried eggs on a freeway-or any number of other ridiculous images. The 
number of far-fetched pathways which can be followed in our brains is without bound, 
just as is the number of insane itineraries that could be planned on an ASU. But just what 
constitutes a "sane" itinerary, given an ASU? And just what constitutes a "reasonable" 
thought, given a brain state? The brain state itself does not forbid anv pathway, because 
for any pathway there are always circumstances which could force the following of that 
pathway. The physical status of a brain, if read correctly, gives information telling not 
which pathways could be followed, but rather how much resistance would be offered 
along the way. 

Now in an ASU, there are many trips which could be taken along two or more 
reasonable alternative routes. For example, the trip from San Francisco to New York 
could go along either a northern route or a southern route. Each of them is quite 
reasonable, but people tend to take them under different circumstances. Looking at a map 
at a given moment in time does not tell you anything about which route will be preferable 
at some remote time in the future -that depends on the external circumstances under which 
the trip is to be taken. Likewise, the "reading" of a brain state will reveal that several 
reasonable alternative pathways are often available, connecting a given set of symbols. 
However, the trip among these symbols need not be imminent; it may be simply one of 
billions of "potential" trips, all of which figure in the readout of the brain state. From this 
follows an important conclusion: there is no information in the brain state itself which 
tells which route will be chosen. The external circumstances will play a large determining 
role in choosing the route. 

What does this imply? It implies that thoughts which clash totally may be 
produced by a single brain, depending on the circumstances. And any high-level readout 
of the brain state which is worth its salt must contain all such conflicting versions. 
Actually this is quite obvious-that we all are bundles of contradictions, and we manage to 
hang together by bringing out only one side of ourselves at a given time. The selection 
cannot be predicted in advance, because the conditions which will force the selection are 
not known in advance. What the brain state can provide, if properly read, is a conditional 
description of the selection of routes. 

Consider, for instance, the Crab's plight, described in the Prelude. He can react in 
various ways to the playing of a piece of music. Sometimes he will be nearly immune to 
it, because he knows it so well. Other times, he will be quite excited by it, but this 
reaction requires the right kind of triggering from the outside-for instance, the presence of 
an enthusiastic listener, to 

Minds and Thoughts 


whom the work is new. Presumably, a high-level reading of the Crab's brain state would 
reveal the potential thrill (and conditions which would induce it), as well as the potential 
numbness (and conditions which would induce it). The brain state itself would not tell 
which one would occur on the next hearing of the piece, however: it could only say, "If 
such-&-such conditions obtain, then a thrill will result; otherwise ..." 

Thus a chunked description of a brain state would give a catalogue of beliefs 
which could be evoked conditionally, dependent on circumstances. Since not all possible 
circumstances can be enumerated, one would have to settle for those which one thinks are 
"reasonable". Furthermore, one would have to settle for a chunked description of the 
circumstances themselves, since they obviously cannot-and should not-be specified down 
to the atomic level! Therefore, one will not be able to make an exact, deterministic 
prediction saying which beliefs will be pulled out of the brain state by a given chunked 
circumstance. In summary, then, a chunked description of a brain state will consist of a 
probabilistic catalogue, in which are listed those beliefs which are most likely to be 
induced (and those symbols which are most likely to be activated) by various sets of 
"reasonably likely" circumstances, themselves described on a chunked level. Trying to 
chunk someone's beliefs without referring to context is precisely as silly as trying to 
describe the range of a single person's "potential progeny" without referring to the mate. 

The same sorts of problems arise in enumerating all the symbols in a given 
person's brain. There are potentially not only an infinite number of pathways in a brain, 
but also an infinite number of symbols. As was pointed out, new concepts can always be 
formed from old ones, and one could argue that the symbols which represent such new 
concepts are merely dormant symbols in each individual, waiting to be awakened. They 
may never get awakened in the person's lifetime, but it could be claimed that those 
symbols are nonetheless always there, just waiting for the right circumstances to trigger 
their synthesis. However, if the probability is very low, it would seem that "dormant" 
would be a very unrealistic term to apply in the situation. To make this clear, try to 
imagine all the "dormant dreams" which are sitting there inside your skull while you're 
awake. Is it conceivable that there exists a decision procedure which could tell 
"potentially dreamable themes" from "undreamable themes", given your brain State 

Where Is the Sense of Self? 

Looking back on what we have discussed, you might think to yourself, "These 
speculations about brain and mind are all well and good, but what about the feelings 
involved in consciousness, These symbols may trigger each other all they want, but 
unless someone perceives the whole thing, there's no consciousness." 

This makes sense to our intuition on some level, but it does not make much sense 
logically. For we would then be compelled to look for an 

Minds and Thoughts 


explanation of the mechanism which does the perceiving of all the active symbols, if it is 
not covered by what we have described so far. Of course, a "soulist" would not have to 
look any further-he would merely assert that the perceiver of all this neural action is the 
soul, which cannot be described in physical terms, and that is that. However, we shall try 
to give a "nonsoulist" explanation of where consciousness arises. 

Our alternative to the soulist explanation-and a disconcerting one it is, too- is to 
stop at ohe symbol level and say, "This is it-this is what consciousness is. Consciousness 
is that property of a system that arises whenever there exist symbols in the system which 
obey triggering patterns somewhat like the ones described in the past several sections." 
Put so starkly, this may seem inadequate. How does it account for the sense of "I", the 
sense of self? 


There is no reason to expect that "I", or "the self", should not be represented by a 
symbol. In fact, the symbol for the self is probably the most complex of all the symbols 
in the brain. For this reason, I choose to put it on a new level of the hierarchy and call it a 
subsystem, rather than a symbol. To be precise, by "subsystem", I mean a constellation of 
symbols, each of which can be separately activated under the control of the subsystem 
itself. The image I wish to convey of a subsystem is that it functions almost as an 
independent "subbrain", equipped with its own repertoire of symbols which can trigger 
each other internally. Of course, there is also much communication between the 
subsystem and the "outside" world- that is, the rest of the brain. "Subsystem" is just 
another name for an overgrown symbol, one which has gotten so complicated that it has 
many subsymbols which interact among themselves. Thus, there is no strict level 
distinction between symbols and subsystems. 

Because of the extensive links between a subsystem and the rest of the brain 
(some of which will be described shortly), it would be very difficult to draw a sharp 
boundary between the subsystem and the outside; but even if the border is fuzzy, the 
subsystem is quite a real thing. The interesting thing about a subsystem is that, once 
activated and left to its own devices, it can work on its own. Thus, two or more 
subsystems of the brain of an individual may operate simultaneously. I have noticed this 
happening on occasion in my own brain: sometimes I become aware that two different 
melodies are running through my mind, competing for "my" attention. Somehow, each 
melody is being manufactured, or "played", in a separate compartment of my brain. Each 
of the systems responsible for drawing a melody out of my brain is presumably activating 
a number of symbols, one after another, completely oblivious to the other system doing 
the same thing. Then they both attempt to communicate with a third subsystem of my 
brain-mv self -symbol- and it is at that point that the " 1 " inside my brain gets wind of 
what's going on: in other words, it starts picking up a chunked description of the activities 
of those two subsystems. 

Minds and Thoughts 


Subsystems and Shared Code 

Typical subsystems might be those that represent the people we know intimately. They 
are represented in such a complex way in our brains that their symbols enlarge to the rank 
of subsystem, becoming able to act autonomously, making use of some resources in our 
brains for support. By this, I mean that a subsystem symbolizing a friend can activate 
many of the symbols in my brain just as I can. For instance, I can fire up my subsystem 
for a good friend and virtually feel myself in his shoes, running through thoughts which 
he might have, activating symbols in sequences which reflect his thinking patterns more 
accurately than my own. It could be said that my model of this friend, as embodied in a 
subsystem of my brain, constitutes my own chunked description of his brain. 

Does this subsystem include, then, a symbol for every symbol which I think is in 
his brain? That would be redundant. Probably the subsystem makes extensive use of 
symbols already present in my brain. For instance, the symbol for "mountain" in my brain 
can be borrowed by the subsystem, when it is activated. The way in which that symbol is 
then used by the subsystem will not necessarily be identical to the way it is used by my 
full brain. In particular, if I am talking with my friend about the Tien Shan mountain 
range in Central Asia (neither of us having been there), and I know that a number of years 
ago he had a wonderful hiking experience in the Alps, then my interpretation of his 
remarks will be colored in part by my imported images of his earlier Alpine experience, 
since I will be trying to imagine how he visualizes the area. 

In the vocabulary we have been building up in this Chapter, we could say that the 
activation of the "mountain" symbol in me is under control of my subsystem 
representing him. The effect of this is to open up a different window onto to my 
memories from the one which I normally use-namely, my "default option" switches from 
the full range of my memories to the set of my memories of his memories. Needless to 
say, my representations of his memories are only approximations to his actual memories, 
which are complex modes of activation of the symbols in his brain, inaccessible to me. 

My representations of his memories are also complex modes of activation of my 
own symbols-those for "primordial" concepts, such as grass, trees, snow, sky, clouds, and 
so on. These are concepts which I must assume are represented in him "identically" to the 
way they are in me. I must also assume a similar representation in him of even more 
primordial notions: the experiences of gravity, breathing, fatigue, color, and so forth. 
Less primordial but perhaps a nearly universal human quality is the enjoyment of 
reaching a summit and seeing a view. Therefore, the intricate processes in my brain 
which are responsible for this enjoyment can be taken over directly by the friend- 
subsystem without much loss of fidelity. 

We could go on to attempt to describe how I understand an entire tale told by my 
friend, a tale filled with many complexities of human relationships and mental 
experiences. But our terminology would quickly become inadequate. There would be 
tricky recursions connected with representa 

Minds and Thoughts 


tions in him of representations in me of representations in him of one thing and another. 
If mutual friends figured in the tale being told, I would unconsciously look for 
compromises between my image of his representations of them, and my own images of 
them. Pure recursion would simply be an inappropriate formalism for dealing with 
symbol amalgams of this type. And I have barely scratched the surface! 
We plainly lack the vocabulary today for describing the complex interactions that are 
possible between symbols. So let us stop before we get bogged down. 

We should note, however, that computer systems are beginning to run into some 
of the some kinds of complexity, and therefore some of these notions have been given 
names. For instance, my "mountain" symbol is analogous to what in computer jargon is 
called shared (or reentrant) codecode which can be used by two or more separate 
timesharing programs running on a single computer. The fact that activation of one 
symbol can have different results when it is part of different subsystems can be explained 
by saying that its code is being processed by different interpreters. Thus, the triggering 
patterns in the "mountain" symbol are not absolute; they are relative to the system within 
which the symbol is activated. 

The reality of such "subbrains" may seem doubtful to some. Perhaps the 
following quote from M. C. Escher, as he discusses how he creates his periodic plane- 
filling drawings, will help to make clear what kind of phenomenon I am referring to: 

While drawing I sometimes feel as if I were a spiritualist medium, controlled 
by the creatures which I am conjuring up. It is as if they themselves decide on 
the shape in which they choose to appear. They take little account of my 
critical opinion during their birth and I cannot exert much influence on the 
measure of their development. They are usually very difficult and obstinate 

Here is a perfect example of the near-autonomy of certain subsystems of the 
brain, once they are activated. Escher's subsystems seemed to him almost to be able to 
override his esthetic judgment. Of course, this opinion must be taken with a grain of salt, 
since those powerful subsystems came into being as a result of his many years of training 
and submission to precisely the forces that molded his esthetic sensitivities. In short, it is 
wrong to divorce the subsystems in Escher's brain from Escher himself or from his 
esthetic judgment. They constitute a vital part of his esthetic sense, where "he" is the 
complete being of the artist. 

The Self-Symbol and Consciousness 

A very important side effect of the self-subsystem is that it can play the role of "soul", in 
the following sense: in communicating constantly with the rest of the subsystems and 
symbols in the brain, it keeps track of what symbols are active, and in what way. This 
means that it has to have symbols for mental activity-in other words, symbols for 
symbols, and symbols for the 
actions of symbols. 

Minds and Thoughts 


Of course, this does not elevate consciousness or awareness to any "magical", 
nonphysical level. Awareness here is a direct effect of the complex hardware and 
software we have described. Still, despite its earthly origin, this way of describing 
awareness-as the monitoring of brain activity by a subsystem of the brain itself-seems to 
resemble the nearly indescribable sensation which we all know and call "consciousness". 
Certainly one can see that the complexity here is enough that many unexpected effects 
could be created. For instance, it is quite plausible that a computer program with this kind 
of structure would make statements about itself which would have a great deal of 
resemblance to statements which people commonly make about themselves. This 
includes insisting that it has free will, that it is not explicable as a "sum of its parts", and 
so on. (On this subject, see the article "Matter, Mind, and Models" by M. Minsky in his 
book Semantic Information Processing.) 

What kind of guarantee is there that a subsystem, such as I have here postulated, 
which represents the self, actually exists in our brains? Could a whole complex network 
of symbols such as has been described above evolve without a self-symbol evolving, 
How could these symbols and their activities play out "isomorphic" mental events to real 
events in the surrounding universe, if there were no symbol for the host organism, All the 
stimuli coming into the system are centered on one small mass in space. It would be quite 
a glaring hole in a brain's symbolic structure not to have a symbol for the physical object 
in which it is housed, and which plays a larger role in the events it mirrors than any other 
object. In fact, upon reflection, it seems that the only way one could make sense of the 
world surrounding a localized animate object is to understand the role of that object in 
relation to the other objects around it. This necessitates the existence of a selfsymbol; and 
the step from symbol to subsystem is merely a reflection of the importance of the self- 
symbol', and is not a qualitative change. 

Our First Encounter with Lucas 

The Oxford philosopher J. R. Lucas (not connected with the Lucas numbers described 
earlier) wrote a remarkable article in 1961, entitled "Minds, Machines, and Godel". His 
views are quite opposite to mine, and yet he manages to mix many of the same 
ingredients together in coming up with his opinions. The following excerpt is quite 
relevant to what we have just been discussing: 

At one's first and simplest attempts to philosophize, one becomes entangled in questions of 
whether when one knows something one knows that one knows it, and what, when one is 
thinking of oneself, is being thought about, and what is doing the thinking. After one has 
been puzzled and bruised by this problem for a long time, one learns not to press these 
questions: the concept of a conscious being is, implicitly, realized to be different from that 
of an unconscious object. In saying that a conscious being knows something, we are saying 
not onh that he knows it, but that he knows that he knows it, and that he knows that he 
knows that he knows it, and so on, as long as we care to pose the 

Minds and Thoughts 


question: there is, we recognize, an infinity here, but it is not an infinite regress in the had 
sense, for it is the questions that peter out, as being pointless, rather than the answers. The 
questions are felt to be pointless because the concept contains within itself the idea of 
being able to go on answering such questions indefinitely. Although conscious beings have 
the power of going on, we do not wish to exhibit this simply as a succession of tasks they 
are able to perform, nor do we see the mind as an infinite sequence of selves and super- 
selves and super-super-selves. Rather, we insist that a conscious being is a unity, and 
though we talk about parts of the mind, we (to so only as a metaphor, and will not allow it 
to be taken literally. 

The paradoxes of consciousness arise because a conscious being can be aware of itself 
as well as of other things, and yet cannot really be construed as being divisible into parts. It 
means that a conscious being can deal with Godelian questions in a was in which a 
machine cannot, because a conscious being can both consider itself and its perform a rice 
and vet not be other than that which did the performance. A machine can be made in a 
manner of speaking to "consider" its performance, but it cannot take this "into account" 
without thereby becoming a different machine, namely the old machine with a "new part" 
added. Btu it is inherent in our idea of a conscious mind that it can reflect upon itself and 
criticize its own performances, and no extra part is required to (to this: it is already 
complete, and has no Achilles' heel. 

The thesis thus begins to become more of a matter of conceptual analysis than 
mathematical discovery. This is borne out by considering another argument put forward by 
Turing. So far, we have constructed only fairly simple and predictable artifacts. When we 
increase the complexity of our machines, there may, perhaps, be surprises in store for us. 
He draws a parallel with a fission pile. Below a certain "critical" size, nothing much 
happens: but above the critical size, the sparks begin to fly. So too, perhaps, with brains 
and machines. Most brains and all machines are, at present, sub-critical"-they react to 
incoming stimuli in a stodgy and uninteresting way, have no ideas of their own, can 
produce only stock responses-but a few brains at present, and possibly some machines in 
the future, are super-critical, and scintillate on their own account. Turing is suggesting that 
it is only a matter of complexity, and that above a certain level of complexity a qualitative 
difference appears, so that "super-critical" machines will be quite unlike the simple ones 
hitherto envisaged. 

This may be so. Complexity often does introduce qualitative differences. Although it 
sounds implausible, it might turn out that above a certain level of complexity, a machine 
ceased to be predictable, even in principle, and started doing things on its own account, or, 
to use a very revealing phrase, it might begin to have a mind of its own. It might begin to 
have a mind of its own. It would begin to have a mind of its own when it was no longer 
entirely predictable and entirely docile, but was capable of doing things which we 
recognized as intelligent, and not just mistakes or random shots, but which we had not 
programmed into it. But then it would cease to be a machine, within the meaning of the act. 
What is at stake in the mechanist debate is not how minds are, or might be, brought into 
being, but how they operate. It is essential for the mechanist thesis that the mechanical 
model of the mind shall operate according to "mechanical principles," that is, that we can 
understand the operation of the whole in terms of the operations of its parts, and the 
operation of each part either shall be determined by its initial state and the construction of 
the machine, or shall be a random choice between a determinate number of determinate 
operations. If the mechanist produces a machine which is so complicated that this ceases to 
hold good of it, then it is no longer a 

Minds and Thoughts 


machine for the purposes of our discussion, no matter how it was constructed. We should 
say, rather, that he had created a mind, in the same sort of sense as we procreate people at 
present. There would then be two ways of bringing new minds into the world, the 
traditional way, by begetting children born of women, and a new way by constructing very, 
very complicated systems of, say, valves and relays. When talking of the second way. we 
should take care to stress that although what was created looked like a machine, it was not 
one really, because it was not just the total of its parts. One could not tell what it was going 
to do merely by knowing the way in which it was built up and the initial state of its parts: 
one could not even tell the limits of what it could do, for even when presented with a 
Godel-type question, it got the answer right. In fact we should say briefly that any system 
which was not floored by the Godel question was eo ipso not a Turing machine, i.e. not a 
machine within the meaning of the act .3 

In reading this passage, my mind constantly boggles at the rapid succession of topics, 
allusions, connotations, confusions, and conclusions. We jump from a Carrollian paradox 
to Godel to Turing to Artificial Intelligence to holism and reductionism, all in the span of 
two brief pages. About Lucas one can say that he is nothing if not stimulating. In the 
following Chapters, we shall come back to many of the topics touched on so tantalizingly 
and fleetingly in this odd passage. 

Minds and Thoughts 


Aria with Diverse Variations 

Achilles has been unable to 'sleep these past few nights. His friend the 
Tortoise has come over tonight, to keep him company during these annoying 

Tortoise: I am so sorry to hear of the troubles that have been plaguing you, my dear 
Achilles. I hope my company will provide a welcome relief from all the unbearable 
stimulation which has kept you awake. Perhaps I will bore you sufficiently that you 
will at long last go to sleep. In that way, I will be of some service. 

Achilles: Oh, no, I am afraid that I have already had some of the world's finest bores try 
their hand at boring me to sleep-and all, sad to say, to no avail. So you will be no 
match for them. No, Mr. T, I invited you over hoping that perhaps you could 
entertain me with a little this or that, taken from number theory, so that I could at 
least while away these long hours in an agreeable fashion. You see, I have found that 
a little number theory does wonders for my troubled psyche. 

Tortoise: How quaint an idea! You know, it reminds me, just a wee bit, of the story of 
poor Count Kaiserling. 

Achilles: Who was he? 

Tortoise: Oh, he was a Count in Saxony in the eighteenth century-a Count of no account, 
to tell the truth-but because of him-well, shall I tell you the story? It is quite 

Achilles: In that case, by all means, do! 

Tortoise: There was a time when the good Count was suffering from sleeplessness, and it 
just so happened that a competent musician lived in the same town, and so Count 
Kaiserling commissioned this musician to compose a set of variations to be played 
by the Count's court harpsichordist for him during his sleepless nights, to make the 
hours pass by more pleasantly. 

Achilles: Was the local composer up to the challenge? 

Tortoise: I suppose so, for after they were done, the Count rewarded him most 
lucratively-he presented him with a gold goblet containing one hundred Louis d'or. 

Achilles: You don't say! I wonder where he came upon such a goblet and all those Louis 
d'or, in the first place. 

Tortoise. Perhaps he saw it in a museum, and took a fancy to it. 

Achilles: Are you suggesting he absconded with it? 

Tortoise: Now, now, I wouldn't put it exactly that way, but ... Those days, Counts could 
get away with most anything. Anyway, it is clear that the Count was most pleased 
with the music, for he was constantly entreating his harpsichordist-a mere lad of a 
fellow, name of Goldberg-to 

Aria with Diverse Variations 


play one or another of these thirty variations. Consequently (and somewhat 
ironically) the variations became attached to the name of young Goldberg, rather 
than to the distinguished Count's name. 
Achilles: You mean, the composer was Bach, and these were the so-called "Goldberg 

Tortoise: Do I ever! Actually, the work was entitled Aria with Diverse Variations, of 
which there are thirty. Do you know how Bach structured these thirty magnificent 

Achilles: Do tell. 

Tortoise: All the pieces-except the final one-are based on a single theme, which he called 
an "aria". Actually, what binds them all together is not a common melody, but a 
common harmonic ground. The melodies may vary, but underneath, there is a 
constant theme. Only in the last variation did Bach take liberties. It is a sort of "post- 
ending ending". It contains extraneous musical ideas having little to do with the 
original Theme-in fact, two German folk tunes. That variation is called a 

Achilles: What else is unusual about the Goldberg Variations? 

Tortoise: Well, every third variation is a canon. First a canon in two canonizing voices 
enter on the SAME note. Second, a canon in which one of the canonizing voices 
enters ONE NOTE HIGHER than the first. Third, one voice enters Two notes higher 
than the other. And so on, until the final canon has entries just exactly one ninth 
apart. Ten canons, all told. And 

Achilles: Wait a minute. Don't I recall reading somewhere or other about fourteen 
recently discovered Goldberg canons ... 

Tortoise: Didn't that appear in the same journal where they recently reported the 
discovery of fourteen previously unknown days in November? 

Achilles: No, it's true. A fellow named Wolff-a musicologist-heard about a special copy 
of the Goldberg Variations in Strasbourg. He went there to examine it, and to his 
surprise, on the back page, as a sort of "post-ending ending", he found these fourteen 
new canons, all based on the first eight notes of the theme of the Goldberg 
Variations. So now it is known that there are in reality forty-four Goldberg 
Variations, not thirty. 

Tortoise: That is, there are forty-four of them, unless some other musicologist discovers 
yet another batch of them in some unlikely spot. And although it seems improbable, 
it is still possible, even if unlikely, that still another batch will be discovered, and 
then another one, and on and on and on ... Why, it might never stop! We may never 
know if or when we have the full complement of Goldberg Variations. 

Achilles: That is a peculiar idea. Presumably, everybody thinks that this latest discovery 
was just a fluke, and that we now really do have all the Goldberg Variations. But just 
supposing that you are right, and some turn up sometime, we shall start to expect 
this kind of thing. At 

Aria with Diverse Variations 


that point, the name "Goldberg Variations" will start to shift slightly in meaning, to 
include not only the known ones, but also any others which might eventually turn up. 
Their number-call it 'g'-is certain to be finite, wouldn't you agree?-but merely 
knowing that g is finite isn't the same as knowing how big g is. Consequently, this 
information won't tell us when the last Goldberg Variation has been located. 
Tortoise: That is certainly true. 

Achilles: Tell me-when was it that Bach wrote these celebrated variations? 

Tortoise: It all happened in the year 1742, when he was Cantor in Leipzig. Achilles: 

1742? Hmm ... That number rings a bell. 
Tortoise: It ought to, for it happens to be a rather interesting number, being a sum of two 

odd primes: 1729 and 13. 
Achilles: By thunder! What a curious fact' I wonder how often one runs across an even 

number with that property. Let's see 

6= 3+3 

8= 3+5 

10= 3+7= 


12= 5+7 



16=3+ 13= 

5+ 11 

18=5+ 13= 

7+ 11 

20=3+ 17= 

7+ 13 

22 = 3 + 19 

= 5 + 17= 11 





28 = 5 + 23 

= 11 + 17 

30 = 7 + 23 

= 11 + 19= 13 + 17 

Now what do you know-according to my little table here, it seems to be quite a 
common occurrence. Yet I don't discern any simple regularity in the table so far. 

Tortoise: Perhaps there is no regularity to be discerned. 

Achilles: But of course there is! I am just not clever enough to spot it right off the bat. 
Tortoise: You seem quite convinced of it. 

Achilles: There's no doubt in my mind. I wonder ... Could it be that ALL even numbers 

(except 4) can be written as a sum of two odd primes? 
Tortoise: Hmm ... That question rings a bell ... Ah, I know why! You're not the first 

person to ask that question. Why, as a matter of fact, in the year 1742, a 

mathematical amateur put forth this very question in a 
Achilles: Did you say 1742? Excuse me for interrupting, but I just noticed that 1742 

happens to be a rather interesting number, being a difference of two odd primes: 

1747 and 5. 

Tortoise: By thunder! What a curious fact! I wonder how often one runs across an even 
number with that property. 

Aria with Diverse Variations 


Achilles: But please don't let me distract you from your story. 

Tortoise: Oh, yes-as I was saying, in 1742. a certain mathematical amateur, whose name 
escapes me momentarily, sent a letter to Euler, who at the time was at the court of 
King Frederick the Great in Potsdam, and-well, shall I tell you the story? It is not 
without charm. Achilles: In that case, by all means, do! 

Tortoise: Very well. In his letter, this dabbler in number theory propounded an unproved 
conjecture to the great Euler: "Every even number can he represented as a sum of 
two odd primes." Now what was that fellow's name? 

Achilles: I vaguely recollect the story, from some number theory book or other. Wasn't 
the fellow named Iiupfergiidel 

Tortoise: Hmm ... No, that sounds too long. 

Achilles: Could it have been "Silberescher"? 

Tortoise: No, that's not it, either. There's a name on the tip of my tongue-ah-ah-oh yes! It 
was "Goldbach" ! Goldbach was the fellow. Achilles: I knew it was something like 

Tortoise: Yes-your guesses helped jog my memory. It's quite odd, how one occasionally 
has to hunt around in one's memory as if for a book in a library without call numbers 
... But let us get back to 1742. 

Achilles: Indeed, let's. I wanted to ask you: did Euler ever prove that this guess by 
Goldbach was right? 

Tortoise: Curiously enough, he never even considered it worthwhile working on. 
However, his disdain was not shared by all mathematicians. In fact, it caught the 
fancy of many, and became known as the "Goldbach Conjecture". 

Achilles: Has it ever been proven correct? 

Tortoise: No, it hasn't. But there have been some remarkable near misses. For instance, in 
1931 the Russian number theorist Schnirelmann proved that any number-even or 
odd-can be represented as the sum of not more than 300,000 primes. 

Achilles: What a strange result. Of what good is it? 

Tortoise: It has brought the problem into the domain of the finite. Previous to 
Schnirelmann's proof, it was conceivable that as you took larger and larger even 
numbers, they would require more and more primes to represent them. Some even 
number might take a trillion primes to represent it! Now it is known that that is not 
so-a sum of 300,000 primes (or fewer) will always suffice. 

Achilles: I see. 

Tortoise: Then in 1937, a sly fellow named Vinogradov-a Russian too-managed to 
establish something far closer to the desired result: namely, every sufficiently large 
ODD number can be represented as a sum of no more than THREE odd primes. For 
example, 1937 = 641 + 643 + 653. We could say that an odd number which is 
representable as a sum of three odd primes has "the Vinogradov property. Thus, all 
sufficiently large odd numbers have the Vinigradov properties 

Aria with Diverse Variations 


Achilles: Very well-but what does "sufficiently large" mean? 

Tortoise: It means that some finite number of odd numbers may fail to have the 
Vinogradov property, but there is a number-call it Vbeyond which all odd numbers 
have the Vinogradov property. But Vinogradov was unable to say how big v is. So in 
a way, v is like g, the finite but unknown number of Goldberg Variations. Merely 
knowing that v is finite isn't the same as knowing how big v is. Consequently, this 
information won't tell us when the last odd number which needs more than three 
primes to represent it has been located. 

Achilles: I see. And so any sufficiently large even number 2N can be represented as a 
sum of FOUR primes, by first representing 2N - 3 as a sum of three primes, and then 
adding back the prime number 3. 

Tortoise: Precisely. Another close approach is contained in the Theorem which says, "All 
even numbers can be represented as a sum of one prime and one number which is a 
product of at most two primes." 

Achilles: This question about sums of two primes certainly leads you into strange 
territory. I wonder where you would be led if you looked at DIFFERENCES of two 
odd primes. I'll bet I could glean some insight into this teaser by making a little table 
of even numbers, and their representations as differences of two odd primes, just as I 
did for sums. Let's see ... 

My gracious! There seems to be no end to the number of different representations I can 
find for these even numbers. Yet I don't discern any simple regularity in the table so 

Tortoise: Perhaps there is no regularity to be discerned. 

Achilles: Oh, you and your constant rumblings about chaos! I'll hear none of that, thank 

Tortoise: Do you suppose that EVERY even number can be represented somehow as the 

difference of two odd primes? 
Achilles: The answer certainly would appear to be yes, from my table. But then again, I 

suppose it could also be no. That doesn't really get us very far, does it? 
Tortoise: With all due respect, I would say there are deeper insights to be had on the 


Achilles: Curious how similar this problem is to Goldbach's original one. Perhaps it 
should be called a "Goldbach Variation". 

Tortoise: Indeed. But you know, there is a rather striking difference between the 
Goldbach Conjecture, and this Goldbach Variation, which I would like to tell you 
about. Let us say that an even number 2N has the "Goldbach property" if it is the 
SUM of two odd primes, and it has the "Tortoise property" if it is the DIFFERENCE 
of two odd primes 

Aria with Diverse Variations 401 

2= 5-3, 7-5, 

4= 7-3, 11-7, 

6 = 11-5, 13-7, 

8=11-3, 13-5, 

10 = 13-3, 17-7, 

23 - 13, 

19-17, etc. 
23 - 19,etc. 
19- 13, etc. 
31 -23,etc. 
29- 19, etc. 


Achilles: I think you should call it the "Achilles property". After all, I suggested the 

Tortoise: I was just about to propose that we should say that a number which LACKS the 
Tortoise property has the "Achilles property". Achilles: Well, all right .. . 

Tortoise: Now consider, for instance, whether I trillion has the Goldbach property or the 
Tortoise property. Of course, it may have both. 

Achilles: I can consider it, but I doubt whether I can give you an answer to either 

Tortoise: Don't give up so soon. Suppose I asked you to answer one or the other question. 

Which one would you pick to work on? 
Achilles: I suppose I would flip a coin. I don't see much difference between them. 
Tortoise: Aha: But there's a world of difference' If you pick the Goldbach property, 

involving SUMS of primes, then you are limited to using primes which are bounded 

between 2 and 1 trillion, right? 
Achilles: Of course. 

Tortoise: So your search for a representation for 1 trillion as a sum of two primes is 

Achilles: Ahhh! I see your point. Whereas if I chose to work on representing 1 trillion as 

the DIFFERENCE of two primes, I would not have any bound on the size of the 

primes involved. They might be so big that it would take me a trillion years to find 


Tortoise: Or then again, they might not even EXIST! After all, that's what the question 
was asking-do such primes exist, It wasn't of much concern how big they might turn 
out to be. 

Achilles: You're right. If they didn't exist, then a search process would lead on forever, 
never answering yes, and never answering no. And nevertheless, the answer would 
be no. 

Tortoise: So if you have some number, and you wish to test whether it has the Goldbach 
property or the Tortoise property, the difference between the two tests will be this: in 
the former, the search involved is GUARANTEED TO TERMINATE; in the latter, 
it is POTENTIALLY ENDLESS-there are no guarantees of any type. It might just 
go merrily on forever, without yielding an answer. And yet, on the other hand, in 
some cases, it might stop on the first step. 

Achilles: I see there is a rather vast difference between the Goldbach and Tortoise 

Tortoise: Yes, the two similar problems concern these vastly different properties. The 
Goldbach Conjecture is to the effect that all even numbers have the Goldbach 
property; the Goldbach Variation suggests that all even numbers have the Tortoise 
property. Both problems are unsolved, but what is interesting is that although they 
sound very much alike, they involve properties of whole numbers which are quite 

Achilles: I see what you mean. The Goldbach property is a detectable, or 

Aria with Diverse Variations 


recognizable property of any even number, since I know how to test for its presence 
just embark on a search. It will automatically come to an end with a yes or no 
answer. The Tortoise property, however, is more elusive, since a brute force search 
just may never give an answer. 
Tortoise: Well, there may be cleverer ways of searching in the case of the Tortoise 
property, and maybe following one of them would always come to an end, and yield 
an answer. 

Achilles: Couldn't the search only end if the answer were yes% 

Tortoise: Not necessarily. There might be some way of proving that whenever the search 
lasts longer than a certain length of time, then the answer must be no. There might 
even be some OTHER way of searching for the primes, not such a brute force way, 
which is guaranteed to find them if they exist, and to tell if they don't. In either case, 
a finite search would be able to yield the answer no. But I don't know if such a thing 
can be proven or not. Searching through infinite spaces is always a tricky matter, you 

Achilles: So as things stand now, you know of no test for the Tortoise property which is 
guaranteed to terminate-and yet there MIGHT exist such a search. 

Tortoise: Right. I suppose one could embark on a search for such a search, but I can give 
no guarantee that that "meta-search" would terminate, either. 

Achilles: You know, it strikes me as quite peculiar that if some even number-for 
example, a trillion-failed to have the Tortoise property, it would be caused by an 
infinite number of separate pieces of information. It's funny to think of wrapping all 
that information up into one bundle, and calling it, as you so gallantly suggested, 
"the Achilles property" of 1 trillion. It is really a property of the number system as a 
"HOLE, not just of the number 1 trillion. 

Tortoise: That is an interesting observation, Achilles, but I maintain that it makes a good 
deal of sense to attach this fact to the number 1 trillion nevertheless. For purposes of 
illustration, let me suggest that you . consider the simpler statement "29 is prime". 
Now in fact, this statement really means that 2 times 2 is not 29, and 5 times 6 is not 
29, and so forth, doesn't it? 

Achilles: It must, I suppose. 

Tortoise: But you are perfectly happy to collect all such facts together, and attach them in 

a bundle to the number 29, saying merely, "29 is prime" 
Achilles: Yes ... 

Tortoise: And the number of facts involved is actually infinite, isn't it:, After all, such 
facts as "4444 times 3333 is not 29" are all part of it, aren't they% 

Achilles: Strictly speaking, I suppose so. But you and I both know that you can't produce 
29 by multiplying two numbers which are both bigger than 29. So in reality, saying 
"29 is prime" is only summarizing a FINITE number of facts about multiplication 

Aria with Diverse Variations 


Tortoise: You can put it that way if you want, but think of this: the fact that two numbers 
which are bigger than 29 can't have a product equal to 29 involves the entire 
structure of the number system. In that sense, that fact in itself is a summary of an 
infinite number of facts. You can't get away from the fact, Achilles, that when you 
say "29 is prime'-', you are actually stating an infinite number of things. 

Achilles: Maybe so, but it feels like just one fact to me. 

Tortoise: That's because an infinitude of facts are contained in your prior knowledge-they 
are embedded implicitly in the way you visualize things. You don't see an explicit 
infinity because it is captured implicitly inside the images you manipulate. 

Achilles: I guess that you're right. It still seems odd to lump a property of the entire 
number system into a unit, and label the unit "primeness of 29" 

Tortoise: Perhaps it seems odd, but it is also quite a convenient way to look at things. 
Now let us come back to your hypothetical idea. If, as you suggested, the number 1 
trillion has the Achilles property, then no matter what prime you add to it, you do not 
get another prime. Such a state of affairs would be caused by an infinite number of 
separate mathematical "events". Now do all these "events" necessarily spring from 
the same source? Do they have to have a common cause? Because if they don't, then 
some sort of "infinite coincidence" has created the fact, rather than an underlying 

Achilles: An "infinite coincidence"? Among the natural numbers, NoTHING is 
coincidental-nothing happens without there being some underlying pattern. Take 7, 
instead of a trillion. I can deal with it more easily, because it is smaller. 7 has the 
Achilles property. 

Tortoise: You're sure? 

Achilles: Yes. Here's why. If you add 2 to it, you get 9, which isn't prime. And if you add 
any other prime to 7, you are adding two odd numbers, resulting in an even number- 
thus you again fail to get a prime. So here the "Achilleanity" of 7, to coin a term, is a 
consequence of just Two reasons: a far cry from any "infinite coincidence". Which 
just goes to support my assertion: that it never takes an infinite number of reasons to 
account for some arithmetical truth. If there WERE some arithmetical fact which 
were caused by an infinite collection of unrelated coincidences, then you could never 
give a finite proof for that truth. And that is ridiculous. 

Tortoise: That is a reasonable opinion, and you are in good company in making it. 

Achilles: Are there actually those who disagree with this view? Such people would have 
to believe that there are "infinite coincidences", that there is chaos in the midst of the 
most perfect, harmonious, and beautiful of all creations: the system of natural 

Tortoise: Perhaps they do; but have you ever considered that such chaos might be an 
integral part of the beauty and harmony? 

Aria with Diverse Variations 


FIGURE 71. Order and Chaos, by M. C. Escher (lithograph, 1950). 

Achilles: Chaos, part of perfection? Order and chaos make a pleasing unity? Heresy! 

Tortoise: Your favorite artist, M. C. Escher, has been known to suggest such a heretical 
point of view in one of his pictures ... And while we're on the subject of chaos, I 
believe that you might be interested in hearing about two different categories of 
search, both of which are guaranteed to terminate. 

Achilles: Certainly. 

Aria with Diverse Variations 


Tortoise: The first type of search- the non-chaotic type-is exemplified by the test involved 
in checking for the Goldbach property. You just look at primes less than 2N, and if 
some pair adds up to 2N, then 2N has the Goldbach property; otherwise, it doesn't. 
This kind of test is not only sure to terminate, but you can predict BY '"HEN it will 
terminate, as well. 

Achilles: So it is a PREDICTABLY TERMINATING test. Are you going to tell me that 
checking for some number-theoretical properties involves tests which are guaranteed 
to terminate, but about which there is no way to know in advance how long they will 

Tortoise: How prophetic of you, Achilles. And the existence of such tests shows that 
there is intrinsic chaos, in a certain sense, in the natural number system. 

Achilles: Well, in that case, I would have to say that people just don't know enough about 
the test. If they did a little more research, they could figure out how long it will take, 
at most, before it terminates. After all, there must always be some rhyme or reason to 
the patterns among integers. There can't just be chaotic patterns which defy 

Tortoise: I can understand your intuitive faith, Achilles. However, it's not always 
justified. Of course, in many cases you are exactly right just because somebody 
doesn't know something, one can't conclude that it is unknowable' But there are 
certain properties of integers for which terminating tests can be proven to exist, and 
yet about which it can also be PROVEN that there is no way to predict in advance 
how long they will take. 

Achilles: I can hardly believe that. It sounds as if the devil himself managed to sneak in 
and throw a monkey wrench into God's beautiful realm of natural numbers' 

Tortoise: Perhaps it will comfort you to know that it is by no means easy, or natural, to 
define a property for which there is a terminating but not PREDICTABLY 
terminating test. Most "natural" properties of integers do admit of predictably 
terminating tests. For example, primeness. squareness, being a power of ten, and so 

Achilles: Yes, I can see that those properties are completely straightforward to test for. 
Will you tell me a property for which the only possible test is a terminating but 
nonpredictable one? 

Tortoise: That's too complicated for me in my sleepy state. Let me instead show you a 
property which is very easy to define, and yet for which no terminating test is 
known. I'm not saying there won't ever be one discovered, mind you just that none is 
known. You begin with a number-would you care to pick one? 

Achilles: How about 15? 

Tortoise: An excellent choice. We begin with your number, and if it is ODD, we triple it, 
and add 1. If it is EVEN, we take half of it. Then we repeat the process. Call a 
number which eventually reaches 1 this way a WONDROUS number, and a number 
which doesn't, an UNWONDROUS number 

Aria with Diverse Variations 


Achilles: Is 15 wondrous, or unwondrous? Let's see: 















s ODD, so I make 3n + 1 : 
s EVEN, so I take half: 
s ODD, so I make 3n + 1 : 
s EVEN, so I take half: 
s ODD, so I make 3n + 1 : 
s EVEN, so I take half: 
s ODD, so I make 3n + 1 : 


















s EVEN, so I take half: 
is EVEN, so I take half: 
is EVEN, so I take half: 
is EVEN, so I take half: 
is EVEN, so I take half: 

s ODD, so I make 3n + 1 : 

s EVEN, so I take half: 
s EVEN, so I take half: 
s EVEN, so I take half: 
s EVEN, so I take half: 

Wow! That's quite a roundabout journey, from 15 to 1. But I finally reached it. That 
shows that 15 has the property of being wondrous. I wonder what numbers are 
UNwondrous ... 

Tortoise: Did you notice how the numbers swung up and down, in this simply defined 

Achilles: Yes. I was particularly surprised, after thirteen turns, to find myself at 16, only 
one greater than 15, the number I started with. In one sense, I was almost back where 
I started-yet in another sense, I' was nowhere near where I had started. Also, I found 
it quite curious that I had to go as high as 160 to resolve the question. I wonder how 

Tortoise: Yes, there is an infinite "sky" into which you can sail, and it is very hard to 
know in advance how high into the sky you will wind up sailing. Indeed, it is quite 
plausible that you might just sail up and up and up, and never come down. 

Achilles: Really? I guess that is conceivable-but what a weird coincidence it would 
require! You'd just have to hit odd number after odd number, with only a few evens 
mixed in. I doubt if that would ever happen-but I just don't know for sure. 

Tortoise: Why don't you try starting with 27? Mind you, I don't promise anything. But 
sometime, just try it, for your amusement. And I'd advise you to bring along a rather 
large sheet of paper. 

Achilles: Hmm ... Sounds interesting. You know, it still makes me feel funny to associate 
the wondrousness (or unwondrousness) with the starting number, when it is so 
obviously a property of the entire number system. 

Tortoise: I understand what you mean, but it's not that different from saying "29 is 
prime" or "gold is valuable" - both statements attribute to 

Aria with Diverse Variations 407 

a single entity a property which it has only by virtue of being embedded in a 
particular context. 

Achilles: I suppose you're right. This "wondrousness" problem is wondrous tricky, 

because of the way in which the numbers oscillate -now increasing, now decreasing. 

The pattern OUGHT to be regular, -yet on the surface it appears to be quite chaotic. 

Therefore, I can well imagine why, as of yet, no one knows of a test for the property 

of wondrousness which is guaranteed to terminate. 
Tortoise: Speaking of terminating and nonterminating processes, and those which hover 

in between, I am reminded of a friend of mine, an author, who is at work on a book. 
Achilles: Oh, how exciting! What is it called? 

Tortoise: Copper, Silver, Gold: an Indestructible Metallic Alloy. Doesn't that sound 

Achilles: Frankly, I'm a little confused by the title. After all, what do Copper, Silver, and 
Gold have to do with each other? Tortoise: It seems clear to me. 

Achilles: Now if the title were, say, Giraffes, Silver, Gold, or Copper, Elephants, Gold, 
why, I could see it .. . 

Tortoise: Perhaps you would prefer Copper, Silver, Baboons? 

Achilles: Oh, absolutely! But that original title is a loser. No one would understand it. 
Tortoise: I'll tell my friend. He'll be delighted to have a catchier title (as will his 

Achilles: I'm glad. But how were you reminded of his book by our discussion? 

Tortoise: Ah, yes. You see, in his book there will be a Dialogue in which he wants to 

throw readers off by making them SEARCH for the ending. 
Achilles: A funny thing to want to do. How is it done? 

Tortoise: You've undoubtedly noticed how some authors go to so much trouble to build 
up great tension a few pages before the end of their stories-but a reader who is 
holding the book physically in his hands can FEEL that the story is about to end. 
Hence, he has some extra information which acts as an advance warning, in a way. 
The tension is a bit spoiled by the physicality of the book. It would be so much better 
if, for instance, there were a lot of padding at the end of novels. 

Achilles: Padding? 

Tortoise: Yes; what I mean is, a lot of extra printed pages which are not part of the story 

proper, but which serve to conceal the exact location of the end from a cursory 

glance, or from the feel of the book. 
Achilles: I see. So a story's true ending might occur, say, fifty or a hundred pages before 

the physical end of the book? 
Tortoise: Yes. This would provide an element of surprise, because the reader wouldn't 

know in advance how many pages are padding, and how many are story. 
Achilles: If this were standard practice, it might be quite effective. But 

Aria with Diverse Variations 


there is a problem. Suppose your padding were very obvious-such as a lot of blanks, 
or pages covered with X's or random letters. Then, it would be as good as absent. 

Tortoise: Granted. You'd have to make it resemble normal printed pages. 

Achilles: But even a cursory glance at a normal page from one story will often suffice to 
distinguish it from another story. So you will have to make the padding resemble the 
genuine story rather closely. 

Tortoise: That's quite true. The way I've always envisioned it is this: you bring the story 
to an end; then without any break, you follow it with something which looks like a 
continuation but which is in reality just padding, and which is utterly unrelated to the 
true theme. The padding is, in a way, a "post-ending ending". It may contain 
extraneous literary ideas, having little to do with the original theme. 

Achilles: Sneaky! But then the problem is that you won't be able to tell when the real 
ending comes. It'll just blend right into the padding. 

Tortoise: That's the conclusion my author friend and I have reached as well. It's a shame, 
for I found the idea rather appealing. 

Achilles: Say, I have a suggestion. The transition between genuine story and padding 
material could be made in such a way that, by sufficiently assiduous inspection of 
the text, an intelligent reader will be able to detect where one leaves off and the other 
begins. Perhaps it will take him quite a while. Perhaps there will be no way to 
predict how long it will take ... But the publisher could give a guarantee that a 
sufficiently assiduous search for the true ending will always terminate, even if he 
can't say how long it will be before the test terminates. 

Tortoise: Very well-but what does "sufficiently assiduous" mean? 

Achilles: It means that the reader must be on the lookout for some small but telltale 
feature in the text which occurs at some point. That would signal the end. And he 
must be ingenious enough to think up, and hunt for, many such features until he 
finds the right one. 

Tortoise: Such as a sudden shift of letter frequencies or word lengths? Or a rash of 
grammatical mistakes? 

Achilles: Possibly. Or a hidden message of some sort might reveal the true end to a 
sufficiently assiduous reader. Who knows? One could even throw in some 
extraneous characters or events which are inconsistent with the spirit of the 
foregoing story. A naive reader would swallow the whole thing, whereas a 
sophisticated reader would be able to spot the dividing line exactly. 

Tortoise: That's a most original idea, Achilles. I'll relay it to my friend, and perhaps he 
can incorporate it in his Dialogue. 

Achilles: I would be highly honored. 

Tortoise: Well, I am afraid that I myself am growing a little groggy, Achilles. It would be 
well for me to take my leave, while I am still capable of navigating my way home. 

Achilles: I am most flattered' that you have stayed up for so long, and at such an odd hour 
of the night, just for my benefit. I assure you that 

Aria with Diverse Variations 


your number-theoretical entertainment has been a perfect antidote to my usual 
tossing and turning. And who knows-perhaps I may even be able to go to sleep 
tonight. As a token of my gratitude, Mr. T, I would like to present you with a special 

Tortoise: Oh, don't be silly, Achilles. 

Achilles: It is my pleasure, Mr. T. Go over to that dresser; on it, you will see an Asian 

( The Tortoise moseys over to Achilles ' dresser.) 

Tortoise. You don't mean this very gold Asian box, do you? 
Achilles: That's the one. Please accept it, Mr. T, with my warmest compliments. 
Tortoise: Thank you very much indeed, Achilles. Hmm ... Why are all these 
mathematicians' names engraved on the top? What a curious list: 

De Morgan 



Br o u w e r 
S i e r p i n s k i 

Achilles: I believe it is supposed to be a Complete List of All Great Mathematicians. 
What I haven't been able to figure out is why the letters running down the diagonal 
are so much bolder. 

Tortoise: At the bottom it says, "Subtract 1 from the diagonal, to find Bach in Leipzig". 
Achilles: I saw that, but I couldn't make head or tail of it. Say, how about a shot of 

excellent whiskey? I happen to have some in that decanter on my shelf. 
Tortoise: No, thanks. I'm too tired. I'm just going to head home. (Casually, he opens the 

box.) Say, wait a moment, Achilles-there are one hundred Louis dor in here! 
Achilles: I would be most pleased if you would accept them, Mr. T. Tortoise: But-but 
Achilles: No objections, now. The box, the gold-they're yours. And thank you for an 

evening without parallel. 
Tortoise: Now whatever has come over you, Achilles? Well, thank you for your 

outstanding generosity and I hope you have sweet dreams about the strange 

Goldbach Conjecture, and its Variation. Good night. 

(And he picks up the very gold Asian box filled with the one hundred Louis d'or, and 
walks towards the door. As he is about to leave, there is a loud knock.) 

Who could be knocking at this ungodly hour, Achilles? 
Achilles: I haven't the foggiest idea. It seems suspicious to me. Why don't you go hide 
behind the dresser, in case there's any funny business. 

Aria with Diverse Variations 


Tortoise: Good idea. (Scrambles in behind the dresser.) Achilles: Who's there? 
Voice: Open up-it's the cops. 
Achilles: Come in, it's open. 

(Two burly policemen walk in, wearing shiny badges.) 

Cop: I'm Silva. This is Gould. (Points at his badge.) Is there an Achilles at this address? 
Achilles: That's me! 

Cop: Well, Achilles, we have reason to believe that there is a very gold Asian box here, 
filled with one hundred Louis d'or. Someone absconded with it from the museum 
this afternoon. Achilles: Heavens to Betsy! 

Cop: If it is here, Achilles, since you would be the only possible suspect, I' regret to say 
that I should have to take you into custody. Now I have here a search warrant 

Achilles: Oh, sirs, am I ever glad you arrived! All evening long, I have been being 
terrorized by Mr. Tortoise and his very Asian gold box. Now at last you have come 
to liberate me! Please, sirs, just take a look behind that dresser, and there you will 
find the culprit! 

(The cops look behind the dresser and spy the Tortoise huddled behind it, holding 
his very gold Asian box, and trembling.) 

Cop: So there it is! And so Mr. Tortoise is the varmint, eh? I never would have suspected 

HIM. But he's caught, red-handed. 
Achilles: Haul the villain away, kind sirs! Thank goodness, that's the last I'll have to hear 

of him, and the Very Asian Gold Box! 

Aria with Diverse Variations 



BlooP and FlooP and GlooP 

Self-Awareness and Chaos 

BLOOP, FLOOP, AND GLOOP are not trolls, talking ducks, or the sounds made by a 
sinking ship-they are three computer languages, each one with is own special purpose. 
These languages were invented specially for this chapter. They will be of use in 
explaining some new senses of the word 'recursive -in particular, the notions of primitive 
recursivity and general recursivity. They will prove very helpful in clarifying the 
machinery of self-reference in TNT. 

We seem to be making a rather abrupt transition from brains and hinds to 
technicalities of mathematics and computer science. Though the transition is abrupt in 
some ways, it makes some sense. We just saw how a certain kind of self-awareness 
seems to be at the crux of consciousness. Vow we are going to scrutinize "self- 
awareness" in more formal settings, such as TNT. The gulf between TNT and a mind is 
wide, but some of the ideas will be most illuminating, and perhaps metaphorically 
transportable back to our thoughts about consciousness. 

One of the amazing things about TNT's self-awareness is that it is intimately 
connected to questions about order versus chaos among the natural numbers. In 
particular, we shall see that an orderly system of sufficient complexity that it can mirror 
itself cannot be totally orderly-it must contain some strange, chaotic features. For readers 
who have some Achilles in them, this will be hard to take. However, there is a "magical" 
compensation: there is a kind of order to the disorder, which is now its own field of 
study, called "recursive function theory". Unfortunately, we will not be able to do much 
more than hint at the fascination of this subject. 

Representability and Refrigerators 

Phrases such as "sufficiently complex", "sufficiently powerful" and the like lave cropped 
up quite often earlier. Just what do they mean? Let us go back to the battle of the Crab 
and Tortoise, and ask, "What qualifies something as a record player?" The Crab might 
claim that his refrigerator s a "Perfect" record player. Then to prove it, he could set any 
record whatsoever atop it, and say, "You see-it's playing it!" The Tortoise, if he wanted to 
counter this Zen-like act, would have to reply, "No-your refrigerator is too low-fidelity to 
be counted as a phonograph: it cannot reproduce sounds-at all (let alone its self-breaking 
sound)." The Tortoise 

BlooP and FlooP and GlooP 


can only make a record called "I Cannot Be Played on Record Player X" provided that 
Record Player X is really a record player! The Tortoise's method is quite insidious, as it 
plays on the strength, rather than on the weakness, of the system. And therefore he 
requires "sufficiently hi-fi" record players. 

Ditto for formal versions of number theory. The reason that TNT is a 
formalization of N is that its symbols act the right way: that is, its theorems are not silent 
like a refrigerator-they speak actual truths of N. Of course, so do the theorems of the pq- 
system. Does it, too, count as "a formalization of number theory", or is it more like a 
refrigerator? Well, it is a little better than a refrigerator, but it is still pretty weak. The pq- 
system does not include enough of the core truths of N to count as "a number theory". 

What, then, are these "core truths" of N? They are the primitive recursive truths; 
that means they involve only predictably terminating calculations. These core truths 
serve for N as Euclid's first four postulates served for geometry: they allow you to throw 
out certain candidates before the game begins, on the grounds of "insufficient power". 
From here on out, the representability of all primitive recursive truths will be the 
criterion for calling a system "sufficiently powerful". 

Ganto's Ax in Metamathematics 

The significance of the notion is shown by the following key fact: If you have a 
sufficiently powerful formalization of number theory, then Godel's method is applicable, 
and consequently your system is incomplete. If, on the other hand, your system is not 
sufficiently powerful (i.e., not all primitive recursive truths are theorems), then your 
system is, precisely by virtue of that lack, incomplete. Here we have a reformulation of 
"Ganto's Ax" in metamathematics: whatever the system does, Godel's Ax will chop its 
head off! Notice also how this completely parallels the high-fidelity-versus-low fidelity 
battle in the Contracrostipunctus . 

Actually, it turns out that much weaker systems are still vulnerable to the Godel method; 
the criterion that all primitive recursive truths need be represented as theorems is far too 
stringent. It is a little like a thief who will only rob "sufficiently rich" people, and whose 
criterion is that the potential victim should be carrying at least a million dollars in cash. 
In the case of TNT, luckily, we will be able to act in our capacity as thieves, for the 
million in cash is there -which is to say, TNT does indeed contain all primitive recursive 
truths as theorems. 

Now before we plunge into a detailed discussion of primitive recursive functions 
and predicates, I would like to tie thee themes of this Chapter to themes from earlier 
Chapters, so as to provide a bit better motivation. 

Finding Order by Choosing the Right Filter 

We saw at a very early stage that formal systems can be difficult and unruly beasts 
because they have lengthening and shortening rules, which can 

BlooP and FlooP and GlooP 


possibly lead to never-ending searches among strings. The discovery of Godel-numbering 
showed that any search for a string having a special typographical property has an 
arithmetical cousin: an isomorphic search for an integer with a corresponding special 
arithmetical property. Consequently, the quest for decision procedures for formal systems 
involves solving the mystery of unpredictably long searches- chaos-among the integers. 
Now in the Aria with Diverse Variations, I gave perhaps too much weight to apparent 
manifestations of chaos in problems about integers. As a matter of fact, people have 
tamed wilder examples of apparent chaos than the "wondrousness" problem, finding them 
to be quite gentle beasts after all. Achilles' powerful faith in the regularity and 
predictability of numbers should therefore be accorded quite a bit of respect-especially as 
it reflects the beliefs of nearly all mathematicians up till the 1930's. To show why order 
versus chaos is such a subtle and significant issue, and to tie it in with questions about the 
location and revelation of meaning, I would like to quote a beautiful and memorable 
passage from Are Quanta Reall-a Galilean Dialogue by the late J. M. Jauch: 

SALVIATI Suppose I give you two sequences of numbers, such as 


1, -1/3, +1/5, -1/7, +1/9, -1/11, +1/13, -1/15, ... 

If I asked you, Simplicio, what the next number of the first sequence is, what 
would you say? 

SIMPLICIO I could not tell you. I think it is a random sequence and that there is 
no law in it. 

SALVIATI And for the second sequence? 

SIMPLICIO That would be easy. It must be +1/17. 

SALVIATI Right. But what would you say if I told you that the first 

sequence is also constructed by a law and this law is in fact identical with the 

one you have just discovered for the second sequence? SIMPLICIO This does not 
seem probable to me. 

SALVIATI But it is indeed so, since the first sequence is simply the beginning of 
the decimal fraction [expansion] of the sum of the second. Its value is Tr/4. 

SIMPLICIO You are full of such mathematical tricks, but I do not see what this 
has to do with abstraction and reality. 

SALVIATI The relationship with abstraction is easy to see. The first sequence 
looks random unless one has developed through a process of abstraction a kind of 
filter which sees a simple structure behind the apparent randomness. 

It is exactly in this manner that laws of nature are discovered. Nature 

presents us with a host of phenomena which appear mostly as chaotic randomness 
until we select some significant events, and abstract from their particular, irrelevant 
circumstances so that they become idealized. Only then can they exhibit their true 
structure in full splendor. 

SAGREDO This is a marvelous idea! It suggests that when we try to understand 
nature, we should look at the phenomena as if they were messages to be 

BlooP and FlooP and GlooP 


understood. Except that each message appears to be random until we establish a code 
to read it. This code takes the form of an abstraction, that is, we choose to ignore 
certain things as irrelevant and we thus partially select the content of the message by 
a free choice. These irrelevant signals form the "background noise," which will limit 
the accuracy of our message. 

But since the code is not absolute there may be several messages in the same raw 
material of the data, so changing the code will result in a message of equally deep 
significance in something that was merely noise before, and conversely: In a new 
code a former message may be devoid of meaning. 

Thus a code presupposes a free choice among different, complementary aspects, 
each of which has equal claim to reality, if I may use this dubious word. 

Some of these aspects may be completely unknown to us now but they may 
reveal themselves to an observer with a different system of abstractions. 

But tell me, Salviati, how can we then still claim that we discover something out 
there in the objective real world? Does this not mean that we are merely creating 
things according to our own images and that reality is only within ourselves? 

SALVIATI I don't think that this is necessarily so, but it is a question which 
requires deeper reflection.' 

Jauch is here dealing with messages that come not from a "sentient being" but from 
nature itself. The questions that we raised in Chapter VI on the relation of meaning to 
messages can be raised equally well with messages from nature. Is nature chaotic, or is 
nature patterned? And what is the role of intelligence in determining the answer to this 

To back off from the philosophy, however, we can consider the point about the 
deep regularity of an apparently random sequence. Might the function Q(n) from Chapter 
V have a simple, nonrecursive explanation, too? Can every problem, like an orchard, be 
seen from such an angle that its secret is revealed? Or are there some problems in number 
theory which, no matter what angle they are seen from, remain mysteries? 

With this prologue, I feel it is time to move ahead to define the precise meaning 
of the term "predictably long search". This will be accomplished in terms of the language 

Primordial Steps of the Language BlooP 

Our topic will be searches for natural numbers which have various properties. In order to 
talk about the length of any search, we shall have to define some primordial steps, out of 
which all searches are built, so that length can be measured in terms of number of steps. 
Some steps which we might consider primordial are: 

adding any two natural numbers; 
multiplying any two natural numbers; 
determining if two numbers are equal; 
determining the larger (smaller) of two numbers. 

BlooP and FlooP and GlooP 


Loops and Upper Bounds 

If we try to formulate a test for, say, primality in terms of such steps, we shall soon see 
that we have to include a control structure-that is, descriptions of the order to do things 
in, when to branch back and try something again, when to skip over a set of steps, when 
to stop, and similar matters. 

It is typical of any algorithm-that is, a specific delineation of how to carry out a task-that 
it includes a mixture of (1) specific operations to be performed, and (2) control 
statements. Therefore, as we develop our language for expressing predictably long 
calculations, we shall have to incorporate primordial control structures also. In fact, the 
hallmark of BlooP is its limited set of control structures. It does not allow you to branch 
to arbitrary steps, or to repeat groups of steps without limit; in BlooP, essentially the only 
control structure is the bounded loop: a set of instructions which can be executed over 
and over again, up to a predefined maximum number of times, called the upper bound, or 
ceiling, of the loop. If the ceiling were 300, then the loop might be executed 0, 7, or 300 
times-but not 301. 

Now the exact values of all the upper bounds in a program need not be put in numerically 
by the programmer-indeed, they may not be known in advance. Instead, any upper bound 
may be determined by calculations carried out before its loop is entered. For instance, if 
you wanted to calculate the value of 2"', there would be two loops. First, you evaluate 3", 
which involves n multiplications. Then, you put 2 to that power, which involves 3" 
multiplications. Thus, the upper bound for the second loop is the result of the calculation 
of the first loop. 

Here is how you would express this in a BlooP program: 


CELL(O) <= 1; 

CELL(0) ' 3 x CELL(O); 

CELL(l) # 2 X CELL(1 ); 

Conventions of BlooP 

Now it is an acquired skill to be able to look at an algorithm written in a computer 
language, and figure out what it is doing. However, I hope that this algorithm is simple 
enough that it makes sense without too much 

BlooP and FlooP and GlooP 


scrutiny. A procedure is defined, having one input parameter, N; its output is the desired 

This procedure definition has what is called block structure, which means that 
certain portions of it are to be considered as units, or blocks. All the statements in a block 
get executed as a unit. Each block has a number (the outermost being BLOCK 0), and is 
delimited by a BEGIN and an END. In our example, BLOCK 1 and BLOCK 2 contain 
just one statement each but shortly you will see longer blocks. A LOOP statement always 
means to execute the block immediately under it repeatedly. As can be seen above, 
blocks can be nested. 

The strategy of the above algorithm is as described earlier. You begin by taking 
an auxiliary variable, called CELL(O); you set it initially to 1, and then, in a loop, you 
multiply it repeatedly by 3 until you've done so exactly N times. Next, you do the 
analogous thing for CELL(l)-set it to 1, multiply by 2 exactly CELL(O) times, then 
quit. Finally, you set OUTPUT to the value of CELL(l). This is the value returned to the 
outside world-the only externally visible behavior of the procedure. 

A number of points about the notation should be made here. First, the meaning of 
the left- arrow <= is this: 

Evaluate the expression to its right, then take the result and set the CELL (or OUTPUT) 
on its left to that value. 

So the meaning of a command such as CELL(l) <= 3 X CELL(l) is to triple the value 
stored in CELL(l). You may think of each CELL as being a separate word in the 
memory of some computer. The only difference between a CELL and a true word is that 
the latter can only hold integers up to some finite limit, whereas we allow a CELL to 
hold any natural number, no matter how big. 

Every procedure in BlooP, when called, yields a value-namely the value of the 
variable called OUTPUT. At the beginning of execution of any procedure, it is assumed 
as a default option that OUTPUT has the value 0. That way, even if the procedure never 
resets OUTPUT at all, OUTPUT has a well-defined value at all times. 

IF-Statements and Branching 

Now let us look at another procedure which will show us some other features of BlooP 
which give it more generality. How do you find out, knowing only how to add, what the 
value of M - N is? The trick is to add various numbers onto N until you find the one 
which yields M. However, what happens if M is smaller than N? What if we are trying to 
take 5 from 2? In the domain of natural numbers, there is no answer. But we would like 
our BlooP procedure to give an answer anyway-let's say 0. Here, then, is a BlooP 
procedure which does subtraction: 

BlooP and FlooP and GlooP 








Here we are making use of the implicit feature that OUTPUT begins at 0. If M is 
less than N, then the subtraction is impossible, and we simply jump to the bottom of 
BLOCK 0 right away, and the answer is 0. That is what is meant by the line QUIT 
BLOCK 0. But if M is not less than N, then we skip over that QUIT-statement, and 
carry out the next command in sequence (here, a LOOP-statement). That is how IF- 
statements always work in BlooP. 

So we enter LOOP 1, so called because the block which it tells us to repeat is 
BLOCK 1. We try adding 0 to N, then 1, 2, etc., until we find a number that gives M. At 
that point, we ABORT the loop we are in, meaning we jump to the statement 
immediately following the END which marks the bottom of the loop's block. In this case, 
that jump brings us just below BLOCK 1: END, which is to say, to the last statement of 
the algorithm, and we are done. OUTPUT now contains the correct answer. 

Notice that there are two distinct instructions for jumping downwards: QUIT, and 
ABORT. The former pertains to blocks, the latter to loops. QUIT BLOCK n means to 
jump to the last line of BLOCK n, whereas ABORT LOOP n means to jump just below 
the last line of BLOCK n. This distinction only matters when you are inside a loop and 
want to continue looping but to quit the block this time around. Then you can say QUIT 
and the proper thing will happen. 

Also notice that the words AT MOST now precede the upper bound of the loop, 
which is a warning that the loop may be aborted before the upper bound is reached. 

Automatic Chunking 

Now there are two last features of BlooP to explain, both of them very important. The 
first is that, once a procedure has been defined, it may be called inside later procedure 
definitions. The effect of this is that once an operation has been defined in a procedure, it 
is considered as simple as a primordial step. Thu